Transcript: Human XM_017018011.1

PREDICTED: Homo sapiens A-kinase interacting protein 1 (AKIP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKIP1 (56672)
Length:
1328
CDS:
97..729

Additional Resources:

NCBI RefSeq record:
XM_017018011.1
NBCI Gene record:
AKIP1 (56672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082529 GCAACCCATGTCTATCGTTAT pLKO.1 433 CDS 100% 10.800 15.120 N AKIP1 n/a
2 TRCN0000311743 GCAACCCATGTCTATCGTTAT pLKO_005 433 CDS 100% 10.800 15.120 N AKIP1 n/a
3 TRCN0000082528 CCACTGTATGATTCTCTTAAT pLKO.1 782 3UTR 100% 13.200 9.240 N AKIP1 n/a
4 TRCN0000349347 CCACTGTATGATTCTCTTAAT pLKO_005 782 3UTR 100% 13.200 9.240 N AKIP1 n/a
5 TRCN0000082530 GACCTCTACATAGAAGTATAT pLKO.1 604 CDS 100% 13.200 9.240 N AKIP1 n/a
6 TRCN0000311744 GACCTCTACATAGAAGTATAT pLKO_005 604 CDS 100% 13.200 9.240 N AKIP1 n/a
7 TRCN0000082532 CCTTCAGAACAATGGCTGAAT pLKO.1 350 CDS 100% 0.495 0.347 N AKIP1 n/a
8 TRCN0000311742 CCTTCAGAACAATGGCTGAAT pLKO_005 350 CDS 100% 0.495 0.347 N AKIP1 n/a
9 TRCN0000082531 CTTCAGAACAATGGCTGAATT pLKO.1 351 CDS 100% 0.000 0.000 N AKIP1 n/a
10 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1140 3UTR 100% 1.080 0.540 Y GPR83 n/a
11 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1140 3UTR 100% 1.080 0.540 Y MYORG n/a
12 TRCN0000362732 TCAAGTCAGTGTGGGAAATAC pLKO_005 385 CDS 100% 13.200 9.240 N Akip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03737 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03737 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475470 TCGCTGACGACCGACTCCTCTTTT pLX_317 61% 100% 100% V5 n/a
Download CSV