Transcript: Human XM_017018367.1

PREDICTED: Homo sapiens transmembrane serine protease 5 (TMPRSS5), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMPRSS5 (80975)
Length:
6891
CDS:
5496..6179

Additional Resources:

NCBI RefSeq record:
XM_017018367.1
NBCI Gene record:
TMPRSS5 (80975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047076 CCTTGCAGGATGAGGAGATAA pLKO.1 3835 5UTR 100% 13.200 9.240 N TMPRSS5 n/a
2 TRCN0000047075 CCATACTTACAGCTCGGATAT pLKO.1 5864 CDS 100% 10.800 7.560 N TMPRSS5 n/a
3 TRCN0000047074 GCACTTCTGGTCAAGTTGTTT pLKO.1 4164 5UTR 100% 5.625 3.938 N TMPRSS5 n/a
4 TRCN0000047077 GTCAAGTTGTTTCCCTCAGAT pLKO.1 4173 5UTR 100% 4.950 3.465 N TMPRSS5 n/a
5 TRCN0000047073 CCCTGATTTCAGAGTCCTCTT pLKO.1 6367 3UTR 100% 4.050 2.835 N TMPRSS5 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12714 pDONR223 100% 51.4% 47.5% None (many diffs) n/a
2 ccsbBroad304_12714 pLX_304 0% 51.4% 47.5% V5 (many diffs) n/a
3 TRCN0000468489 TCCATTACACTCTTACTAGCCCTT pLX_317 28.8% 51.4% 47.5% V5 (many diffs) n/a
Download CSV