Construct: ORF TRCN0000468489
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000920.1_s317c1
- Derived from:
- ccsbBroadEn_12714
- DNA Barcode:
- TCCATTACACTCTTACTAGCCCTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMPRSS5 (80975)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468489
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 80975 | TMPRSS5 | transmembrane serine protea... | NM_001288750.2 | 97% | 96.9% | 0_1ins36;970T>C;973T>C |
2 | human | 80975 | TMPRSS5 | transmembrane serine protea... | NM_001288751.1 | 94.6% | 94.6% | (many diffs) |
3 | human | 80975 | TMPRSS5 | transmembrane serine protea... | NM_030770.4 | 91.5% | 91.9% | (many diffs) |
4 | human | 80975 | TMPRSS5 | transmembrane serine protea... | NM_001288749.2 | 80.7% | 80.7% | (many diffs) |
5 | human | 80975 | TMPRSS5 | transmembrane serine protea... | NM_001288752.2 | 76.5% | 76.8% | (many diffs) |
6 | human | 80975 | TMPRSS5 | transmembrane serine protea... | NR_110047.2 | 62.3% | (many diffs) | |
7 | human | 80975 | TMPRSS5 | transmembrane serine protea... | NR_110046.2 | 61.1% | (many diffs) | |
8 | human | 80975 | TMPRSS5 | transmembrane serine protea... | XM_017018366.1 | 51.4% | 47.5% | (many diffs) |
9 | human | 80975 | TMPRSS5 | transmembrane serine protea... | XM_017018367.1 | 51.4% | 47.5% | (many diffs) |
10 | human | 80975 | TMPRSS5 | transmembrane serine protea... | XR_001747992.1 | 18.6% | (many diffs) | |
11 | human | 80975 | TMPRSS5 | transmembrane serine protea... | XR_001747990.1 | 18.2% | (many diffs) | |
12 | human | 80975 | TMPRSS5 | transmembrane serine protea... | XR_001747991.1 | 17.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1344
- ORF length:
- 1275
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gattgatgtt tctcaggcgg tgtgctggcg ttccatgcga cgtggctgtg 121 cagtgctggg agccctgggg ctgctggccg gtgcaggtgt tggctcatgg ctcctagtgc 181 tgtatctgtg tcctgctgcc tctcagccca tttccgggac cttgcaggat gaggagataa 241 ctttgagctg ctcagaggcc agcgctgagg aagctctgct ccctgcactt cccaaaacag 301 tatctttcag aataaacagc gaagacttct tgctggaagc gcaagtgagg gatcagccac 361 gctggctcct ggtctgccat gagggctgga gccccgccct ggggctgcag atctgctgga 421 gccttgggca tctcagactc actcaccaca agggagtaaa cctcactgac atcaaactca 481 acagttccca ggagtttgct cagctctctc ctagactggg aggcttcctg gaggaggcgt 541 ggcagcccag gaacaactgc acttctggtc aagttgtttc cctcagatgc tctgagtgtg 601 gagcgaggcc cctggcttcc cggatagttg gtgggcagtc tgtggctcct gggcgctggc 661 cgtggcaggc cagcgtggcc ctgggcttcc ggcacacgtg tgggggctct gtgctagcgc 721 cacgctgggt ggtgactgct gcacattgta tgcacagttt caggctggcc cgcctgtcca 781 gctggcgggt tcatgcgggg ctggtcagcc acagtgccgt caggccccac caaggggctc 841 tggtggagag gattatccca caccccctct acagtgccca gaatcatgac tacgacgtcg 901 ccctcctgag gctccagacc gctctcaact tctcagacac tgtgggcgct gtgtgcctgc 961 cggccaagga acagcatttT CCGAAGGGCT CGCGGTGCTG GGTGTCTGGC TGGGGCCACA 1021 CCCACCCTAG CCATACTTAC AGCTCGGATA TGCTCCAGGA CACGGTGGTG CCCCTGCTCA 1081 GCACTCAGCT CTGCAACAGC TCTTGCGTGT ACAGCGGAGC CCTCACCCCC CGCATGCTTT 1141 GCGCTGGCTA CCTGGACGGA AGGGCTGATG CATGCCAGGG AGATAGCGGG GGCCCCCTAG 1201 TGTGCCCAGA TGGGGACACA TGGCGCCTAG TGGGGGTGGT CAGCTGGGGG CGTGGCTGCG 1261 CAGAGCCCAA TCACCCAGGT GTCTACGCCA AGGTAGCTGA GTTTCTGGAC TGGATCCATG 1321 ACACTGCTCA GGACTCCCTC CTCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1381 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1441 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT CCATTACACT 1501 CTTACTAGCC CTTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1561 att