Transcript: Human XM_017018749.1

PREDICTED: Homo sapiens keratin 71 (KRT71), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRT71 (112802)
Length:
2138
CDS:
190..1515

Additional Resources:

NCBI RefSeq record:
XM_017018749.1
NBCI Gene record:
KRT71 (112802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018749.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116846 CCACCAGGTTACCGTCAATGA pLKO.1 249 CDS 100% 4.950 6.930 N KRT71 n/a
2 TRCN0000116845 GTGCCAACGATTACAAAGACA pLKO.1 1442 CDS 100% 3.000 4.200 N KRT71 n/a
3 TRCN0000116843 GCTTACGCCAATAAGGTGGAA pLKO.1 673 CDS 100% 2.640 3.696 N KRT71 n/a
4 TRCN0000419579 ACATCTAGCTCAGTCTCAAAT pLKO_005 1978 3UTR 100% 13.200 9.240 N KRT71 n/a
5 TRCN0000423540 GAGATTGCCTTGAAGAGTAAG pLKO_005 871 CDS 100% 10.800 7.560 N KRT71 n/a
6 TRCN0000116842 CCTAGCATAGTTCCTGCCTAT pLKO.1 1881 3UTR 100% 4.050 2.835 N KRT71 n/a
7 TRCN0000116844 CTCAGAGATCGAGAACGTGAA pLKO.1 1020 CDS 100% 4.050 2.835 N KRT71 n/a
8 TRCN0000116954 CCTCCTTCATCGACAAGGTAT pLKO.1 368 CDS 100% 4.950 2.475 Y KRT8P11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018749.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09379 pDONR223 100% 84.1% 83.9% None (many diffs) n/a
2 ccsbBroad304_09379 pLX_304 0% 84.1% 83.9% V5 (many diffs) n/a
3 TRCN0000471794 CGTGTGGTGATATAGAGAAACATC pLX_317 26.4% 84.1% 83.9% V5 (many diffs) n/a
4 ccsbBroadEn_13575 pDONR223 100% 49.1% 48.9% None (many diffs) n/a
5 ccsbBroad304_13575 pLX_304 0% 49.1% 48.9% V5 (many diffs) n/a
6 TRCN0000478787 CAGGTATTATTAGAGCATTGGAGC pLX_317 28% 49.1% 48.9% V5 (many diffs) n/a
Download CSV