Transcript: Human XM_017018786.2

PREDICTED: Homo sapiens leucine rich repeat kinase 2 (LRRK2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRK2 (120892)
Length:
4868
CDS:
243..4817

Additional Resources:

NCBI RefSeq record:
XM_017018786.2
NBCI Gene record:
LRRK2 (120892)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358257 TAGGCTTACATTAGGTAATTT pLKO_005 1067 CDS 100% 15.000 21.000 N LRRK2 n/a
2 TRCN0000021463 CCCAAATTGGTGGAACTCTTA pLKO.1 2505 CDS 100% 4.950 6.930 N LRRK2 n/a
3 TRCN0000021460 CCCAGGATGTTGGAAATGATT pLKO.1 547 CDS 100% 5.625 3.938 N LRRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465878 ACACTGGGATAATCTTGTACGCTG pLX_317 4.4% 60.2% 59.6% V5 (many diffs) n/a
2 ccsbBroadEn_15231 pDONR223 12.5% 58.5% 2.4% None (many diffs) n/a
3 ccsbBroad304_15231 pLX_304 0% 58.5% 2.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV