Transcript: Human XM_017018820.2

PREDICTED: Homo sapiens chemerin chemokine-like receptor 1 (CMKLR1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CMKLR1 (1240)
Length:
5237
CDS:
325..1440

Additional Resources:

NCBI RefSeq record:
XM_017018820.2
NBCI Gene record:
CMKLR1 (1240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367733 TCGCCTGGTCAATGCTCTAAG pLKO_005 1314 CDS 100% 10.800 15.120 N CMKLR1 n/a
2 TRCN0000011275 CCCTGATTATTTAGACTCCAT pLKO.1 372 CDS 100% 2.640 3.696 N CMKLR1 n/a
3 TRCN0000011278 CTTCAAGATTATTGTGACCAT pLKO.1 1092 CDS 100% 2.640 3.696 N CMKLR1 n/a
4 TRCN0000356843 AGCCTTGGACTAGCAATTTAT pLKO_005 1640 3UTR 100% 15.000 12.000 N CMKLR1 n/a
5 TRCN0000011274 CCTCTTTAGCATCCACCAATT pLKO.1 1521 3UTR 100% 10.800 8.640 N CMKLR1 n/a
6 TRCN0000356909 TGATGAATACCCTGATTATTT pLKO_005 363 CDS 100% 15.000 10.500 N CMKLR1 n/a
7 TRCN0000356844 ATCACACTTGGCCCTTGTATA pLKO_005 1854 3UTR 100% 13.200 9.240 N CMKLR1 n/a
8 TRCN0000011276 GCTTTACCAAGATGTCATCAA pLKO.1 1373 CDS 100% 4.950 3.465 N CMKLR1 n/a
9 TRCN0000011277 CCTGGCTTACATGGCCTGCAT pLKO.1 780 CDS 100% 0.880 0.616 N CMKLR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488274 ATCCATAGAACGATGCTTCAATTC pLX_317 28.9% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488290 CTGTGACTAATGTACAGGAGTAAC pLX_317 20% 99.9% 99.7% V5 1113_1114insG n/a
3 ccsbBroadEn_00335 pDONR223 100% 99.4% 99.4% None 0_1insATGAGA n/a
4 ccsbBroad304_00335 pLX_304 0% 99.4% 99.4% V5 0_1insATGAGA n/a
5 TRCN0000480389 TCCGAGGTGCGGGTCTGAATCAAA pLX_317 37.6% 99.4% 99.4% V5 0_1insATGAGA n/a
Download CSV