Transcript: Human XM_017018859.1

PREDICTED: Homo sapiens glycosyltransferase 1 domain containing 1 (GLT1D1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLT1D1 (144423)
Length:
839
CDS:
20..727

Additional Resources:

NCBI RefSeq record:
XM_017018859.1
NBCI Gene record:
GLT1D1 (144423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244004 GTCGCTTTCACAGAGTCAATG pLKO_005 590 CDS 100% 10.800 8.640 N GLT1D1 n/a
2 TRCN0000150003 CACAGAGTCAATGAAGGAAAT pLKO.1 598 CDS 100% 10.800 7.560 N GLT1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018859.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13224 pDONR223 100% 55.6% 54.4% None (many diffs) n/a
2 ccsbBroad304_13224 pLX_304 0% 55.6% 54.4% V5 (many diffs) n/a
3 TRCN0000468079 CTAACGTCTCAGGCCCGACTTGTC pLX_317 67% 55.6% 54.4% V5 (many diffs) n/a
Download CSV