Transcript: Human XM_017018876.2

PREDICTED: Homo sapiens F-box and leucine rich repeat protein 14 (FBXL14), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXL14 (144699)
Length:
1452
CDS:
125..1288

Additional Resources:

NCBI RefSeq record:
XM_017018876.2
NBCI Gene record:
FBXL14 (144699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018876.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245550 ACCAGAGTCTGGCTTACATAG pLKO_005 1005 CDS 100% 10.800 7.560 N FBXL14 n/a
2 TRCN0000257448 CCAGAAGCTCACAGATCTTTC pLKO_005 760 CDS 100% 10.800 7.560 N FBXL14 n/a
3 TRCN0000180800 GCCAGAAGCTCACAGATCTTT pLKO.1 759 CDS 100% 5.625 3.938 N FBXL14 n/a
4 TRCN0000245553 TGCGCTCCTGTGACAACATCA pLKO_005 903 CDS 100% 4.950 3.465 N FBXL14 n/a
5 TRCN0000245552 CTGCTACAACCTCACCGACAA pLKO_005 421 CDS 100% 4.050 2.430 N FBXL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018876.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09614 pDONR223 100% 91.9% 92.1% None (many diffs) n/a
2 ccsbBroad304_09614 pLX_304 0% 91.9% 92.1% V5 (many diffs) n/a
3 TRCN0000467182 AGCTGAGAAGCTCAGATATCAATT pLX_317 22.6% 91.9% 92.1% V5 (many diffs) n/a
Download CSV