Transcript: Human XM_017018889.1

PREDICTED: Homo sapiens aldehyde dehydrogenase 1 family member L2 (ALDH1L2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALDH1L2 (160428)
Length:
7745
CDS:
772..3105

Additional Resources:

NCBI RefSeq record:
XM_017018889.1
NBCI Gene record:
ALDH1L2 (160428)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415440 GACGGTGACACTGGAATATTA pLKO_005 3084 CDS 100% 15.000 21.000 N ALDH1L2 n/a
2 TRCN0000422521 AGCTGAAGTTGGCACTAATTG pLKO_005 238 5UTR 100% 13.200 18.480 N ALDH1L2 n/a
3 TRCN0000414353 GAATCCATCCACGACGAATTT pLKO_005 2545 CDS 100% 13.200 18.480 N ALDH1L2 n/a
4 TRCN0000436420 GGAATCCTTTGGGCCTATTAT pLKO_005 2805 CDS 100% 15.000 10.500 N ALDH1L2 n/a
5 TRCN0000427798 GTGGCAAGTCTCCACTTATAA pLKO_005 2420 CDS 100% 15.000 10.500 N ALDH1L2 n/a
6 TRCN0000155970 CCTGGAGAACCACTGGAAATT pLKO.1 1165 CDS 100% 13.200 9.240 N ALDH1L2 n/a
7 TRCN0000150510 GCCATACCAGTGTTTCATAAA pLKO.1 1656 CDS 100% 13.200 9.240 N ALDH1L2 n/a
8 TRCN0000179462 GCGGATGTTGATAAAGCAGTA pLKO.1 1771 CDS 100% 4.050 2.835 N ALDH1L2 n/a
9 TRCN0000154597 GCTTCCTAAATGGAGGGTCAA pLKO.1 404 5UTR 100% 4.050 2.835 N ALDH1L2 n/a
10 TRCN0000151018 GCTCTATCATTTATCACCCAT pLKO.1 541 5UTR 100% 2.640 1.848 N ALDH1L2 n/a
11 TRCN0000138395 CCTTCCAAGTAGCTGGGATTA pLKO.1 6047 3UTR 100% 10.800 5.400 Y C11orf88 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 6134 3UTR 100% 4.950 2.475 Y LOC387873 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6171 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6171 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10320 pDONR223 100% 62.8% 62.5% None 1_348del;1804_1834del;1844_2331del n/a
2 ccsbBroad304_10320 pLX_304 0% 62.8% 62.5% V5 1_348del;1804_1834del;1844_2331del n/a
3 TRCN0000474398 TGCAGATCTCCTTCAACGTGGCGC pLX_317 35% 62.8% 62.5% V5 1_348del;1804_1834del;1844_2331del n/a
Download CSV