Transcript: Human XM_017019303.1

PREDICTED: Homo sapiens LDL receptor related protein 1 (LRP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRP1 (4035)
Length:
15072
CDS:
565..14250

Additional Resources:

NCBI RefSeq record:
XM_017019303.1
NBCI Gene record:
LRP1 (4035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019303.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053253 CGCCGGATGTATAAATGTAAA pLKO.1 14346 3UTR 100% 13.200 18.480 N LRP1 n/a
2 TRCN0000257100 GATCCGTGTGAACCGCTTTAA pLKO_005 1881 CDS 100% 13.200 18.480 N LRP1 n/a
3 TRCN0000053254 GCGAACAAACACACTGGCTAA pLKO.1 5103 CDS 100% 4.050 5.670 N LRP1 n/a
4 TRCN0000230616 GTCCAACTACACGTTACTTAA pLKO_005 9753 CDS 100% 13.200 10.560 N LRP1 n/a
5 TRCN0000230615 GATGCCTATCTGGACTATATT pLKO_005 1717 CDS 100% 15.000 10.500 N LRP1 n/a
6 TRCN0000257134 ACAGCTTCCTGAGGGCTAATT pLKO_005 14628 3UTR 100% 13.200 9.240 N LRP1 n/a
7 TRCN0000053255 CGGAGTGGTATTCTGGTATAA pLKO.1 13929 CDS 100% 13.200 9.240 N LRP1 n/a
8 TRCN0000219021 ACATCGATGATAGGATCTTTG pLKO_005 1460 CDS 100% 10.800 7.560 N LRP1 n/a
9 TRCN0000053257 CCGCGAGGACTACATTGAATT pLKO.1 10239 CDS 100% 0.000 0.000 N LRP1 n/a
10 TRCN0000053256 CCTGCAACAATGGCAGATGTA pLKO.1 3512 CDS 100% 4.950 2.970 N LRP1 n/a
11 TRCN0000176045 GCAACATCTACTGGACAGATT pLKO.1 6545 CDS 100% 4.950 2.970 N Ldlr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019303.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10952 pDONR223 100% 6.3% 6.1% None (many diffs) n/a
2 ccsbBroad304_10952 pLX_304 0% 6.3% 6.1% V5 (many diffs) n/a
3 TRCN0000472269 CTTTCGCACCTTGTACGGACCGCT pLX_317 38.9% 6.3% 6.1% V5 (many diffs) n/a
Download CSV