Transcript: Human XM_017019343.1

PREDICTED: Homo sapiens neural EGFL like 2 (NELL2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NELL2 (4753)
Length:
3479
CDS:
356..2821

Additional Resources:

NCBI RefSeq record:
XM_017019343.1
NBCI Gene record:
NELL2 (4753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303388 ATGTGACAGTCGTGCTAATTG pLKO_005 2065 CDS 100% 13.200 18.480 N NELL2 n/a
2 TRCN0000054311 CCCTACAGATTGACGTCTTAA pLKO.1 435 CDS 100% 13.200 9.240 N NELL2 n/a
3 TRCN0000216636 CCCTACAGATTGACGTCTTAA pLKO.1 435 CDS 100% 13.200 9.240 N Nell2 n/a
4 TRCN0000250093 CCCTACAGATTGACGTCTTAA pLKO_005 435 CDS 100% 13.200 9.240 N Nell2 n/a
5 TRCN0000303389 GTAAAGCAAAGAAGCTATAAC pLKO_005 3248 3UTR 100% 13.200 9.240 N NELL2 n/a
6 TRCN0000054310 CCTACTTTGAAGGAGAAAGAA pLKO.1 1389 CDS 100% 5.625 3.938 N NELL2 n/a
7 TRCN0000292016 CCTACTTTGAAGGAGAAAGAA pLKO_005 1389 CDS 100% 5.625 3.938 N NELL2 n/a
8 TRCN0000054309 CCCACTTAAATTCAGGAGTTA pLKO.1 642 CDS 100% 4.950 3.465 N NELL2 n/a
9 TRCN0000054308 CGAGAATTTGAGTCCTGGATA pLKO.1 1214 CDS 100% 4.950 3.465 N NELL2 n/a
10 TRCN0000292014 CGAGAATTTGAGTCCTGGATA pLKO_005 1214 CDS 100% 4.950 3.465 N NELL2 n/a
11 TRCN0000054312 GCTTCAATTTGGATGGCGGAT pLKO.1 2226 CDS 100% 2.160 1.512 N NELL2 n/a
12 TRCN0000292015 GCTTCAATTTGGATGGCGGAT pLKO_005 2226 CDS 100% 2.160 1.512 N NELL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019343.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01083 pDONR223 100% 99.3% 99.2% None 680_694del n/a
2 ccsbBroad304_01083 pLX_304 0% 99.3% 99.2% V5 680_694del n/a
3 TRCN0000492312 GCTGTTCGGTAGTCACGTTCATAA pLX_317 6.5% 99.3% 99.2% V5 680_694del n/a
Download CSV