Transcript: Human XM_017019385.2

PREDICTED: Homo sapiens centrosomal protein 83 (CEP83), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP83 (51134)
Length:
5597
CDS:
550..2655

Additional Resources:

NCBI RefSeq record:
XM_017019385.2
NBCI Gene record:
CEP83 (51134)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242816 TTACGATGTGAGCATCATAAA pLKO_005 667 CDS 100% 13.200 18.480 N CEP83 n/a
2 TRCN0000215427 GATCGTGAATTAATACGTAAA pLKO.1 1666 CDS 100% 10.800 15.120 N Cep83 n/a
3 TRCN0000242819 GATCGTGAATTAATACGTAAA pLKO_005 1666 CDS 100% 10.800 15.120 N CEP83 n/a
4 TRCN0000248032 GATCGTGAATTAATACGTAAA pLKO_005 1666 CDS 100% 10.800 15.120 N Cep83 n/a
5 TRCN0000242815 GCATAAAGCTGAACGAGAAAT pLKO_005 1443 CDS 100% 13.200 10.560 N CEP83 n/a
6 TRCN0000242817 AGGCTGAAGTAGCGGAATTAA pLKO_005 1232 CDS 100% 15.000 10.500 N CEP83 n/a
7 TRCN0000167263 CATACATTTCTCAAGTCAGAA pLKO.1 1012 CDS 100% 4.950 3.465 N CEP83 n/a
8 TRCN0000168559 GAGCTACAATCAAGCAGTGAA pLKO.1 1396 CDS 100% 4.950 3.465 N CEP83 n/a
9 TRCN0000168620 GTAGCGGAATTAAAGGCTGAA pLKO.1 1240 CDS 100% 4.050 2.835 N CEP83 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11953 pDONR223 100% 79.6% 74.8% None (many diffs) n/a
2 ccsbBroad304_11953 pLX_304 0% 79.6% 74.8% V5 (many diffs) n/a
3 TRCN0000474221 AGAGGAAGCCAATAGCGCCGGCAT pLX_317 25.4% 79.6% 74.8% V5 (many diffs) n/a
Download CSV