Transcript: Human XM_017019407.2

PREDICTED: Homo sapiens cyclin dependent kinase 17 (CDK17), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK17 (5128)
Length:
3665
CDS:
464..1972

Additional Resources:

NCBI RefSeq record:
XM_017019407.2
NBCI Gene record:
CDK17 (5128)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146845 ACATAGACGGATCTCAATGG pXPR_003 AGG 412 27% 4 0.9536 CDK17 CDK17 76788
2 BRDN0001149453 CCCTGCACAGCTATAAGAGA pXPR_003 AGG 710 47% 7 0.2371 CDK17 CDK17 76786
3 BRDN0001147014 CTTTCAAGAAGCCCCCATTG pXPR_003 CGG 207 14% 3 -0.0708 CDK17 CDK17 76787
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379809 ATGTAACTATAGCTGCAATTT pLKO_005 2220 3UTR 100% 13.200 18.480 N CDK17 n/a
2 TRCN0000006241 GCGGAATCATTGCTGCTAAAT pLKO.1 2277 3UTR 100% 13.200 18.480 N CDK17 n/a
3 TRCN0000297344 GCGGAATCATTGCTGCTAAAT pLKO_005 2277 3UTR 100% 13.200 18.480 N CDK17 n/a
4 TRCN0000006243 GCAGATAAACAGTCCACCATT pLKO.1 946 CDS 100% 4.950 6.930 N CDK17 n/a
5 TRCN0000195214 CATGTGTACTTTCGAAGTCTG pLKO.1 1808 CDS 100% 4.050 5.670 N CDK17 n/a
6 TRCN0000006242 CGGATCTCAATGGAGGATTTA pLKO.1 866 CDS 100% 13.200 10.560 N CDK17 n/a
7 TRCN0000380030 TCAGAACTGAAGGCAATTATT pLKO_005 2027 3UTR 100% 15.000 10.500 N CDK17 n/a
8 TRCN0000194654 CCAGAAAGTGTATCAATATTC pLKO.1 1850 CDS 100% 13.200 9.240 N CDK17 n/a
9 TRCN0000280076 CCAGAAAGTGTATCAATATTC pLKO_005 1850 CDS 100% 13.200 9.240 N CDK17 n/a
10 TRCN0000023171 CCCACAAAGACCTACTCAAAT pLKO.1 1421 CDS 100% 13.200 9.240 N Cdk17 n/a
11 TRCN0000194897 CTGAAGGAATTGAGTTGATAA pLKO.1 1731 CDS 100% 13.200 9.240 N CDK17 n/a
12 TRCN0000297345 CTGAAGGAATTGAGTTGATAA pLKO_005 1731 CDS 100% 13.200 9.240 N CDK17 n/a
13 TRCN0000194688 CAGCTATTGATGTAACTATAG pLKO.1 2211 3UTR 100% 10.800 7.560 N CDK17 n/a
14 TRCN0000196448 GATGAATCATTGTCTGAATTG pLKO.1 518 CDS 100% 10.800 7.560 N CDK17 n/a
15 TRCN0000280010 GATGAATCATTGTCTGAATTG pLKO_005 518 CDS 100% 10.800 7.560 N CDK17 n/a
16 TRCN0000382027 TCTGTTTCTCCTCACGAATTG pLKO_005 2373 3UTR 100% 10.800 7.560 N CDK17 n/a
17 TRCN0000006245 CCACCAGTACACAGGATCTTT pLKO.1 637 CDS 100% 5.625 3.938 N CDK17 n/a
18 TRCN0000280077 CCACCAGTACACAGGATCTTT pLKO_005 637 CDS 100% 5.625 3.938 N CDK17 n/a
19 TRCN0000006244 GCCATGAAACATGTGTACTTT pLKO.1 1799 CDS 100% 5.625 3.938 N CDK17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01156 pDONR223 100% 95.9% 95.9% None 809_810ins63 n/a
2 ccsbBroad304_01156 pLX_304 0% 95.9% 95.9% V5 809_810ins63 n/a
3 TRCN0000465231 TTTGATACAAACCTCAAATCAGCC pLX_317 14% 95.9% 95.9% V5 809_810ins63 n/a
4 ccsbBroadEn_14731 pDONR223 0% 95.9% 95.9% None 809_810ins63 n/a
5 ccsbBroad304_14731 pLX_304 0% 95.9% 95.9% V5 809_810ins63 n/a
6 TRCN0000468143 AAGTCCCTTTCATCCGCTTGAGTT pLX_317 26.5% 95.9% 95.9% V5 809_810ins63 n/a
7 TRCN0000488011 TCACCTCCAGCAGAACGCTGCTGA pLX_317 21.5% 95.9% 95.9% V5 (not translated due to prior stop codon) 809_810ins63 n/a
Download CSV