Transcript: Human XM_017019762.2

PREDICTED: Homo sapiens SIN3-HDAC complex associated factor (SINHCAF), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SINHCAF (58516)
Length:
3078
CDS:
285..950

Additional Resources:

NCBI RefSeq record:
XM_017019762.2
NBCI Gene record:
SINHCAF (58516)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263880 GGTGGTAGAATATACTATAAT pLKO_005 2826 3UTR 100% 15.000 21.000 N SINHCAF n/a
2 TRCN0000240922 GTTGTGGGATCATCTATAAAG pLKO_005 802 CDS 100% 13.200 18.480 N Fam60a n/a
3 TRCN0000263879 TATGTTGTGGGATCATCTATA pLKO_005 799 CDS 100% 13.200 18.480 N SINHCAF n/a
4 TRCN0000282848 CAAGCCTTGCTGCAGCAATAA pLKO_005 860 CDS 100% 13.200 9.240 N SINHCAF n/a
5 TRCN0000263878 GAAGGAATTTAAACGTCATAA pLKO_005 620 CDS 100% 13.200 9.240 N SINHCAF n/a
6 TRCN0000263881 TCTCGATTCACTGACAGTAAA pLKO_005 360 CDS 100% 13.200 9.240 N SINHCAF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019762.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03867 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03867 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474084 TACTTACACATCATTTATTACCTA pLX_317 66.4% 100% 100% V5 n/a
4 ccsbBroadEn_12419 pDONR223 100% 33% 33% None 1_444del n/a
5 ccsbBroad304_12419 pLX_304 0% 33% 33% V5 1_444del n/a
6 TRCN0000466073 AATTCCCCCCCCAGACCGACGGGC pLX_317 100% 33% 33% V5 1_444del n/a
Download CSV