Transcript: Human XM_017019847.1

PREDICTED: Homo sapiens solute carrier family 6 member 13 (SLC6A13), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC6A13 (6540)
Length:
1400
CDS:
54..1031

Additional Resources:

NCBI RefSeq record:
XM_017019847.1
NBCI Gene record:
SLC6A13 (6540)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042917 CGGGTCTTGAAGATCTCTGAT pLKO.1 621 CDS 100% 4.950 6.930 N SLC6A13 n/a
2 TRCN0000042913 CGTCTACTACATCATTGTGTT pLKO.1 431 CDS 100% 4.950 3.960 N SLC6A13 n/a
3 TRCN0000423193 CTACCTCGTCTTCCTCTTTAC pLKO_005 272 CDS 100% 10.800 7.560 N SLC6A13 n/a
4 TRCN0000042916 CCAGTGTATCCAGTCATGGAA pLKO.1 99 CDS 100% 3.000 2.100 N SLC6A13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000469635 CTCGCGCCTGGTAACTGACACCCA pLX_317 22.5% 53% 51.9% V5 (many diffs) n/a
2 ccsbBroadEn_15594 pDONR223 0% 25.3% 21.4% None (many diffs) n/a
3 ccsbBroad304_15594 pLX_304 0% 25.3% 21.4% V5 (many diffs) n/a
Download CSV