Transcript: Human XM_017020348.2

PREDICTED: Homo sapiens NEDD4 binding protein 2 like 2 (N4BP2L2), transcript variant X34, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
N4BP2L2 (10443)
Length:
2776
CDS:
111..1862

Additional Resources:

NCBI RefSeq record:
XM_017020348.2
NBCI Gene record:
N4BP2L2 (10443)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122131 GAAGGGATAAAGTGATTCTAA pLKO.1 2543 3UTR 100% 5.625 7.875 N N4BP2L2 n/a
2 TRCN0000141115 CCATCAAGATGGGTACAGGTA pLKO.1 1427 CDS 100% 2.640 3.696 N N4BP2L2 n/a
3 TRCN0000121978 GCCAGTTCTTGAAGGGATAAA pLKO.1 2533 3UTR 100% 13.200 9.240 N N4BP2L2 n/a
4 TRCN0000143431 GCTCAGATGTTGGATCGTTAT pLKO.1 1695 CDS 100% 10.800 7.560 N N4BP2L2 n/a
5 TRCN0000143622 GCCAGACAAATATCCCTGTAA pLKO.1 836 CDS 100% 4.950 3.465 N N4BP2L2 n/a
6 TRCN0000143279 GCTGATTGATCTGTGTGACAA pLKO.1 2333 3UTR 100% 4.950 3.465 N N4BP2L2 n/a
7 TRCN0000142804 CCTAGAGAAGAAGTAACGAGT pLKO.1 147 CDS 100% 2.640 1.848 N N4BP2L2 n/a
8 TRCN0000145053 CTCAGGAACAATTTGTTCCAT pLKO.1 706 CDS 100% 0.300 0.210 N N4BP2L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020348.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02435 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02435 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475837 AAATCACTCTTTCATCCATTGCCA pLX_317 16.1% 100% 100% V5 n/a
Download CSV