Transcript: Human XM_017020389.1

PREDICTED: Homo sapiens relaxin family peptide receptor 2 (RXFP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RXFP2 (122042)
Length:
1288
CDS:
61..1212

Additional Resources:

NCBI RefSeq record:
XM_017020389.1
NBCI Gene record:
RXFP2 (122042)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009002 GCGCTTGTTTACGGGATTAAA pLKO.1 738 CDS 100% 15.000 21.000 N RXFP2 n/a
2 TRCN0000357369 AGCGCTTGTTTACGGGATTAA pLKO_005 737 CDS 100% 13.200 18.480 N RXFP2 n/a
3 TRCN0000357412 TAAAGTCTGTGCCGATGATTT pLKO_005 446 CDS 100% 13.200 18.480 N RXFP2 n/a
4 TRCN0000357371 AGTGGATGGGCGACCATATTT pLKO_005 310 CDS 100% 15.000 10.500 N RXFP2 n/a
5 TRCN0000357413 ATCAGCTAACTTGGCTAATTC pLKO_005 686 CDS 100% 13.200 9.240 N RXFP2 n/a
6 TRCN0000009004 CCTCAGATTGATTACAATGTT pLKO.1 96 CDS 100% 5.625 3.938 N RXFP2 n/a
7 TRCN0000009005 CGAGGGCAGTATCAGAAGTAT pLKO.1 1265 3UTR 100% 5.625 3.938 N RXFP2 n/a
8 TRCN0000174897 GCCTAGAAATCAAATTGGTTT pLKO.1 924 CDS 100% 4.950 3.465 N Rxfp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489500 AAACCTTTTAACAAGGGCAAGTTT pLX_317 16.6% 50.6% 50.5% V5 1146G>T;1148_1149delGCins1115 n/a
2 TRCN0000489954 CTCTACCCACCGTTAGCTGGATCC pLX_317 17.3% 50.6% 50.5% V5 (not translated due to prior stop codon) 1146G>T;1148_1149delGCins1115 n/a
Download CSV