Transcript: Human XM_017020396.1

PREDICTED: Homo sapiens dachshund family transcription factor 1 (DACH1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DACH1 (1602)
Length:
4259
CDS:
317..1570

Additional Resources:

NCBI RefSeq record:
XM_017020396.1
NBCI Gene record:
DACH1 (1602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118088 GCACTTGAGTTTGAGACGAAA pLKO.1 1376 CDS 100% 4.950 6.930 N DACH1 n/a
2 TRCN0000287040 GCACTTGAGTTTGAGACGAAA pLKO_005 1376 CDS 100% 4.950 6.930 N DACH1 n/a
3 TRCN0000294327 AGATAGTCTCAGGGTCTTAAA pLKO_005 1441 CDS 100% 13.200 10.560 N DACH1 n/a
4 TRCN0000294326 CAATTGTATACAGAGTTAAAG pLKO_005 1840 3UTR 100% 13.200 9.240 N DACH1 n/a
5 TRCN0000118087 CCTGTTTGTTATGTGGATTAA pLKO.1 3618 3UTR 100% 13.200 9.240 N DACH1 n/a
6 TRCN0000118089 CTGTTGAAAGTTGCCATAGAT pLKO.1 1175 CDS 100% 5.625 3.938 N DACH1 n/a
7 TRCN0000287041 CTGTTGAAAGTTGCCATAGAT pLKO_005 1175 CDS 100% 5.625 3.938 N DACH1 n/a
8 TRCN0000085975 GAGCAACTATCATGCCAGTAA pLKO.1 349 CDS 100% 4.950 3.465 N Dach1 n/a
9 TRCN0000118091 GCTGTTGAAAGTTGCCATAGA pLKO.1 1174 CDS 100% 4.950 3.465 N DACH1 n/a
10 TRCN0000424048 ACTACTGTCATGTACTGAATA pLKO_005 1553 CDS 100% 13.200 9.240 N Dach1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020396.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13842 pDONR223 100% 64.1% 4.6% None 0_1ins457;103_258del n/a
2 ccsbBroad304_13842 pLX_304 0% 64.1% 4.6% V5 (not translated due to prior stop codon) 0_1ins457;103_258del n/a
3 TRCN0000474576 CCGCATCAATTTCGCCTCTGTCTC pLX_317 17.9% 64.1% 4.6% V5 (not translated due to prior stop codon) 0_1ins457;103_258del n/a
Download CSV