Transcript: Human XM_017020495.1

PREDICTED: Homo sapiens MCF.2 cell line derived transforming sequence like (MCF2L), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MCF2L (23263)
Length:
5352
CDS:
113..3661

Additional Resources:

NCBI RefSeq record:
XM_017020495.1
NBCI Gene record:
MCF2L (23263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048202 CGACATCGCTTTCAAATTCAA pLKO.1 724 CDS 100% 5.625 7.875 N MCF2L n/a
2 TRCN0000048199 CGTACCAGACTTACACGGTTA pLKO.1 790 CDS 100% 4.050 5.670 N MCF2L n/a
3 TRCN0000048201 TGGGTGAATGAAATTCGGAAA pLKO.1 2999 CDS 100% 4.050 3.240 N MCF2L n/a
4 TRCN0000048198 CCTCCAGGAAATCGAGAAGTT pLKO.1 1678 CDS 100% 4.950 3.465 N MCF2L n/a
5 TRCN0000048200 CTTCACAACAAGAAGGATGTT pLKO.1 2213 CDS 100% 4.950 3.465 N MCF2L n/a
6 TRCN0000110014 GTTTGGAAACATGGAGGAAAT pLKO.1 2236 CDS 100% 10.800 6.480 N Mcf2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11708 pDONR223 100% 82.6% 81.4% None (many diffs) n/a
2 ccsbBroad304_11708 pLX_304 0% 82.6% 81.4% V5 (many diffs) n/a
3 TRCN0000467665 TTAGCTTTGATTCAATATCGGCAC pLX_317 12.1% 82.6% 81.4% V5 (many diffs) n/a
Download CSV