Transcript: Human XM_017020561.1

PREDICTED: Homo sapiens karyopherin subunit alpha 3 (KPNA3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KPNA3 (3839)
Length:
4157
CDS:
171..1664

Additional Resources:

NCBI RefSeq record:
XM_017020561.1
NBCI Gene record:
KPNA3 (3839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375209 GGAACGTCACATGGGTCATTG pLKO_005 751 CDS 100% 10.800 15.120 N Kpna3 n/a
2 TRCN0000065320 GCAGAATGTAATACCACCGTT pLKO.1 1325 CDS 100% 2.640 3.696 N KPNA3 n/a
3 TRCN0000293950 TTGTCCTCCACAAACATATTT pLKO_005 2106 3UTR 100% 15.000 10.500 N KPNA3 n/a
4 TRCN0000065318 GCTGTAATAGATGCTGGATTA pLKO.1 1185 CDS 100% 10.800 7.560 N KPNA3 n/a
5 TRCN0000286473 GCTGTAATAGATGCTGGATTA pLKO_005 1185 CDS 100% 10.800 7.560 N KPNA3 n/a
6 TRCN0000065322 CCACATCAGAATGTTTGTGAA pLKO.1 603 CDS 100% 4.950 3.465 N KPNA3 n/a
7 TRCN0000286474 CCACATCAGAATGTTTGTGAA pLKO_005 603 CDS 100% 4.950 3.465 N KPNA3 n/a
8 TRCN0000065319 GCTCTGTCATACTTGACAGAT pLKO.1 891 CDS 100% 0.495 0.347 N KPNA3 n/a
9 TRCN0000293908 CACCGATTGATGACTTAATAA pLKO_005 412 CDS 100% 15.000 9.000 N KPNA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06502 pDONR223 100% 95% 94.6% None (many diffs) n/a
2 ccsbBroad304_06502 pLX_304 0% 95% 94.6% V5 (many diffs) n/a
3 TRCN0000478199 TCGGTTCTCAAACTCTCAATGTTG pLX_317 16.4% 95% 94.6% V5 (many diffs) n/a
Download CSV