Transcript: Human XM_017020686.1

PREDICTED: Homo sapiens ring finger protein 6 (RNF6), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF6 (6049)
Length:
2839
CDS:
421..951

Additional Resources:

NCBI RefSeq record:
XM_017020686.1
NBCI Gene record:
RNF6 (6049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033703 GCGTCAAGGAACAACTAGCAT pLKO.1 653 CDS 100% 3.000 4.200 N RNF6 n/a
2 TRCN0000333720 GCGTCAAGGAACAACTAGCAT pLKO_005 653 CDS 100% 3.000 4.200 N RNF6 n/a
3 TRCN0000033701 GCACAGGAAATGCAACTCGAA pLKO.1 776 CDS 100% 2.640 2.112 N RNF6 n/a
4 TRCN0000333805 GCACAGGAAATGCAACTCGAA pLKO_005 776 CDS 100% 2.640 2.112 N RNF6 n/a
5 TRCN0000033702 CCATAACAGTTCCTCTTCGTA pLKO.1 1092 3UTR 100% 3.000 2.100 N RNF6 n/a
6 TRCN0000333722 CCATAACAGTTCCTCTTCGTA pLKO_005 1092 3UTR 100% 3.000 2.100 N RNF6 n/a
7 TRCN0000033700 GCTCAGGCAATTACCTTGCAT pLKO.1 1648 3UTR 100% 3.000 2.100 N RNF6 n/a
8 TRCN0000333723 GCTCAGGCAATTACCTTGCAT pLKO_005 1648 3UTR 100% 3.000 2.100 N RNF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01409 pDONR223 100% 25.6% 21% None 408_409ins704;528_529ins823 n/a
2 ccsbBroad304_01409 pLX_304 0% 25.6% 21% V5 408_409ins704;528_529ins823 n/a
3 TRCN0000491933 GGATTTGAACTAAGAGAGCCATTC pLX_317 21.3% 25.6% 21% V5 408_409ins704;528_529ins823 n/a
Download CSV