Transcript: Human XM_017020747.1

PREDICTED: Homo sapiens ribonuclease H2 subunit B (RNASEH2B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNASEH2B (79621)
Length:
1665
CDS:
322..1098

Additional Resources:

NCBI RefSeq record:
XM_017020747.1
NBCI Gene record:
RNASEH2B (79621)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020747.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412724 ACACCATTCTTGGTTTATAAA pLKO_005 528 CDS 100% 15.000 21.000 N RNASEH2B n/a
2 TRCN0000417500 ATCAAACTGTGGCAGCATTAA pLKO_005 836 CDS 100% 13.200 9.240 N RNASEH2B n/a
3 TRCN0000146305 CTACCTCATAAAGGCTGATAA pLKO.1 618 CDS 100% 13.200 9.240 N RNASEH2B n/a
4 TRCN0000129159 GCTTCTCCACTACCTCATAAA pLKO.1 609 CDS 100% 13.200 9.240 N RNASEH2B n/a
5 TRCN0000147515 GTGGATAACGTGTTTCCAAAT pLKO.1 673 CDS 100% 10.800 7.560 N RNASEH2B n/a
6 TRCN0000149184 CCTGGACTTGAGAAGTTACTT pLKO.1 715 CDS 100% 5.625 3.938 N RNASEH2B n/a
7 TRCN0000128137 CTGACTACATCCCTAAAGAAT pLKO.1 971 CDS 100% 5.625 3.938 N RNASEH2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020747.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14264 pDONR223 100% 75% 73% None (many diffs) n/a
2 ccsbBroad304_14264 pLX_304 0% 75% 73% V5 (many diffs) n/a
3 TRCN0000474704 CGGACGCACTCTTTTGGTGATCTT pLX_317 27.2% 75% 73% V5 (many diffs) n/a
Download CSV