Transcript: Human XM_017020995.1

PREDICTED: Homo sapiens mirror-image polydactyly 1 (MIPOL1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MIPOL1 (145282)
Length:
5485
CDS:
624..2183

Additional Resources:

NCBI RefSeq record:
XM_017020995.1
NBCI Gene record:
MIPOL1 (145282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020995.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118725 CTTCGAGTTTACTACAGTTTA pLKO.1 1638 CDS 100% 13.200 18.480 N MIPOL1 n/a
2 TRCN0000118723 CCTTCGAGTTTACTACAGTTT pLKO.1 1637 CDS 100% 4.950 6.930 N MIPOL1 n/a
3 TRCN0000433241 AGAAGAATGGAGCTATAATTG pLKO_005 1336 CDS 100% 13.200 10.560 N MIPOL1 n/a
4 TRCN0000376132 GACATGACATTACAGGAATTA pLKO_005 1275 CDS 100% 13.200 9.240 N Mipol1 n/a
5 TRCN0000118726 GCTTCAGCAGAAATTGGCTAA pLKO.1 1010 CDS 100% 4.050 2.835 N MIPOL1 n/a
6 TRCN0000121622 GCACTAATAGAAGAACGGGAT pLKO.1 1416 CDS 100% 2.160 1.512 N MIPOL1 n/a
7 TRCN0000118724 GCATCGGAAATCCACTGAATT pLKO.1 737 CDS 100% 0.000 0.000 N MIPOL1 n/a
8 TRCN0000162985 GAGACAAGGTTTCACCATGTT pLKO.1 2049 CDS 100% 4.950 2.475 Y LINC00336 n/a
9 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1957 CDS 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020995.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10711 pDONR223 100% 8.2% 6.9% None (many diffs) n/a
2 ccsbBroad304_10711 pLX_304 0% 8.2% 6.9% V5 (many diffs) n/a
3 TRCN0000465823 AGATATATCGTTTCAACCCTCACC pLX_317 100% 8.2% 6.9% V5 (many diffs) n/a
Download CSV