Transcript: Human XM_017021117.1

PREDICTED: Homo sapiens protein phosphatase 1 regulatory subunit 13B (PPP1R13B), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R13B (23368)
Length:
4881
CDS:
110..3478

Additional Resources:

NCBI RefSeq record:
XM_017021117.1
NBCI Gene record:
PPP1R13B (23368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421282 TCCCATACCCTTTGATCATAT pLKO_005 262 CDS 100% 13.200 10.560 N PPP1R13B n/a
2 TRCN0000001911 GCCTCAACCATAAGCGACATT pLKO.1 3149 CDS 100% 4.950 3.960 N PPP1R13B n/a
3 TRCN0000426912 GTCATCAGATGCCAATGATAA pLKO_005 2566 CDS 100% 13.200 9.240 N PPP1R13B n/a
4 TRCN0000434129 TCGCCTCCAAGGACTGAATTT pLKO_005 3678 3UTR 100% 13.200 9.240 N PPP1R13B n/a
5 TRCN0000436161 TTCTCCAGTTTGCCCATTAAC pLKO_005 3643 3UTR 100% 13.200 9.240 N PPP1R13B n/a
6 TRCN0000430595 AGCTACCAGGAGCCACTTAAG pLKO_005 3510 3UTR 100% 10.800 7.560 N PPP1R13B n/a
7 TRCN0000421854 CAGATTCGTAACCAACTTAAC pLKO_005 926 CDS 100% 10.800 7.560 N PPP1R13B n/a
8 TRCN0000001914 CCTGTCGAGATGTTGTAGAAT pLKO.1 180 CDS 100% 5.625 3.938 N PPP1R13B n/a
9 TRCN0000001912 CACTCATCCTTTCTCACACTT pLKO.1 3913 3UTR 100% 4.950 3.465 N PPP1R13B n/a
10 TRCN0000001915 GTCTCTCAGTATTGCCTCAAA pLKO.1 1204 CDS 100% 4.950 3.465 N PPP1R13B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021117.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02755 pDONR223 100% 96.6% 96.5% None 0_1insATGATGCCG;1142_1246del n/a
2 ccsbBroad304_02755 pLX_304 0% 96.6% 96.5% V5 0_1insATGATGCCG;1142_1246del n/a
3 TRCN0000477224 ACTGCCACTGATAAACTACCGCGT pLX_317 14% 96.6% 96.5% V5 0_1insATGATGCCG;1142_1246del n/a
4 ccsbBroadEn_14081 pDONR223 100% 96.5% 45.6% None (many diffs) n/a
5 ccsbBroad304_14081 pLX_304 0% 96.5% 45.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000467453 GTTTATTAAAGCCAACTTGATCGC pLX_317 10.1% 96.5% 45.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV