Transcript: Human XM_017021241.1

PREDICTED: Homo sapiens syntaxin binding protein 6 (STXBP6), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STXBP6 (29091)
Length:
4364
CDS:
677..1309

Additional Resources:

NCBI RefSeq record:
XM_017021241.1
NBCI Gene record:
STXBP6 (29091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381407 ATGAGCGTGGAGAGCGATTAG pLKO_005 1197 CDS 100% 10.800 15.120 N STXBP6 n/a
2 TRCN0000381023 TAAACTGCGCTGAGTCTAAAC pLKO_005 1648 3UTR 100% 10.800 15.120 N STXBP6 n/a
3 TRCN0000123260 GCAGAGTTTGATTTGTTGTTT pLKO.1 968 CDS 100% 5.625 7.875 N STXBP6 n/a
4 TRCN0000197918 GCAGAGTTTGATTTGTTGTTT pLKO.1 968 CDS 100% 5.625 7.875 N Stxbp6 n/a
5 TRCN0000380487 CCCTAATGATCTTGCTAATAA pLKO_005 1489 3UTR 100% 15.000 10.500 N STXBP6 n/a
6 TRCN0000217860 GACAGGAAGCCAGAGTTTATT pLKO.1 1082 CDS 100% 15.000 10.500 N Stxbp6 n/a
7 TRCN0000381452 GACAGGAAGCCAGAGTTTATT pLKO_005 1082 CDS 100% 15.000 10.500 N STXBP6 n/a
8 TRCN0000380110 GGATTCGGCAGAGTTTGATTT pLKO_005 961 CDS 100% 13.200 9.240 N STXBP6 n/a
9 TRCN0000380299 TTTGAAGGCTCCACATCATTT pLKO_005 878 CDS 100% 13.200 9.240 N STXBP6 n/a
10 TRCN0000380309 AGTCAAGCAGTGATTAGTTTC pLKO_005 1758 3UTR 100% 10.800 7.560 N STXBP6 n/a
11 TRCN0000380930 CAAGTCAAGAGGAGGACAAAG pLKO_005 746 CDS 100% 10.800 7.560 N STXBP6 n/a
12 TRCN0000123263 CAGAGTTTATTAACTGCCAAT pLKO.1 1092 CDS 100% 4.050 2.835 N STXBP6 n/a
13 TRCN0000123261 CCACATCATTTGTTCGGAGAT pLKO.1 888 CDS 100% 4.050 2.835 N STXBP6 n/a
14 TRCN0000123262 GCCAGAGTTTATTAACTGCCA pLKO.1 1090 CDS 100% 0.660 0.462 N STXBP6 n/a
15 TRCN0000123259 CCACTGTGTGTATGTGTGTAT pLKO.1 1553 3UTR 100% 4.950 2.475 Y STXBP6 n/a
16 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3117 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03076 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03076 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472447 GCCATGGAATGACCACCAAATTTC pLX_317 57.3% 100% 100% V5 n/a
Download CSV