Transcript: Human XM_017021479.1

PREDICTED: Homo sapiens pellino E3 ubiquitin protein ligase family member 2 (PELI2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PELI2 (57161)
Length:
14911
CDS:
9529..10491

Additional Resources:

NCBI RefSeq record:
XM_017021479.1
NBCI Gene record:
PELI2 (57161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151627 GCAAAGGTCAACACAGTATAT pLKO.1 9446 5UTR 100% 13.200 18.480 N PELI2 n/a
2 TRCN0000151513 CCATTGTTAATGCTGGGTAAA pLKO.1 13977 3UTR 100% 10.800 15.120 N PELI2 n/a
3 TRCN0000151948 CCAGAGAGTTAGGTATATCAT pLKO.1 12549 3UTR 100% 5.625 7.875 N PELI2 n/a
4 TRCN0000154729 GCCGGATTTGACTCTTCCAAA pLKO.1 9700 CDS 100% 4.950 6.930 N PELI2 n/a
5 TRCN0000155172 GCCTCATGGAACTCATGCATT pLKO.1 10386 CDS 100% 4.950 3.465 N PELI2 n/a
6 TRCN0000153521 CAGATCAACAGAAAGCCCTAT pLKO.1 9543 CDS 100% 4.050 2.835 N PELI2 n/a
7 TRCN0000154430 GAACCTTACACAGCACGGATA pLKO.1 9673 CDS 100% 4.050 2.835 N PELI2 n/a
8 TRCN0000150316 CCAGAACTGTTTGGTTGATTA pLKO.1 11242 3UTR 100% 13.200 7.920 N PELI2 n/a
9 TRCN0000369741 GCCTTTAGTCAAAGCTCATAT pLKO_005 5652 5UTR 100% 13.200 6.600 Y ZNF232 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021479.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000477173 GCAAGACGTCATATGTCCCCACTC pLX_317 26.5% 76.1% 76.1% V5 0_1ins300 n/a
2 ccsbBroadEn_08713 pDONR223 100% 76.1% 76.1% None 0_1ins300;951T>A n/a
3 ccsbBroad304_08713 pLX_304 0% 76.1% 76.1% V5 0_1ins300;951T>A n/a
4 ccsbBroadEn_03799 pDONR223 100% 76.1% 76.1% None 0_1ins300 n/a
5 ccsbBroad304_03799 pLX_304 0% 76.1% 76.1% V5 0_1ins300 n/a
Download CSV