Transcript: Human XM_017021602.2

PREDICTED: Homo sapiens SIX homeobox 1 (SIX1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIX1 (6495)
Length:
2680
CDS:
301..822

Additional Resources:

NCBI RefSeq record:
XM_017021602.2
NBCI Gene record:
SIX1 (6495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312812 ACGCCAGGAGCTCAAACTATT pLKO_005 960 3UTR 100% 13.200 18.480 N Six1 n/a
2 TRCN0000329865 ACGCCAGGAGCTCAAACTATT pLKO_005 960 3UTR 100% 13.200 18.480 N SIX1 n/a
3 TRCN0000015235 CAAGAACGAGAGCGTACTCAA pLKO.1 432 CDS 100% 4.950 6.930 N SIX1 n/a
4 TRCN0000329803 CAAGAACGAGAGCGTACTCAA pLKO_005 432 CDS 100% 4.950 6.930 N SIX1 n/a
5 TRCN0000015234 CCAGACCAGAACTCGGTCCTT pLKO.1 917 3UTR 100% 0.880 0.704 N SIX1 n/a
6 TRCN0000015236 CAATAACTCCTCCTCCAACAA pLKO.1 817 CDS 100% 4.950 3.465 N SIX1 n/a
7 TRCN0000329879 CAATAACTCCTCCTCCAACAA pLKO_005 817 CDS 100% 4.950 3.465 N SIX1 n/a
8 TRCN0000015237 CCACGCCAGGAGCTCAAACTA pLKO.1 958 3UTR 100% 1.875 1.313 N SIX1 n/a
9 TRCN0000015233 AGCTTGTTTCTGGAGTTGTTT pLKO.1 1191 3UTR 100% 5.625 3.375 N SIX1 n/a
10 TRCN0000329805 AGCTTGTTTCTGGAGTTGTTT pLKO_005 1191 3UTR 100% 5.625 3.375 N SIX1 n/a
11 TRCN0000374221 ACCAGTTCTCGCCTCACAATC pLKO_005 518 CDS 100% 10.800 6.480 N Six1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06951 pDONR223 100% 60.7% 59.1% None 295C>T;499_500ins59;519_520ins274 n/a
2 ccsbBroad304_06951 pLX_304 0% 60.7% 59.1% V5 295C>T;499_500ins59;519_520ins274 n/a
3 TRCN0000468669 TGGCTCCAGTACTTTTATCGAAGA pLX_317 6.1% 60.7% 59.1% V5 295C>T;499_500ins59;519_520ins274 n/a
4 ccsbBroadEn_07671 pDONR223 100% 52.6% 55.3% None (many diffs) n/a
5 ccsbBroad304_07671 pLX_304 0% 52.6% 55.3% V5 (many diffs) n/a
6 TRCN0000467949 TCAACACTCCCATCGGCATACTCT pLX_317 43.7% 52.6% 55.3% V5 (many diffs) n/a
Download CSV