Transcript: Human XM_017021825.2

PREDICTED: Homo sapiens regulator of G protein signaling 6 (RGS6), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RGS6 (9628)
Length:
4444
CDS:
524..1954

Additional Resources:

NCBI RefSeq record:
XM_017021825.2
NBCI Gene record:
RGS6 (9628)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021825.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014320 CGACGTTTGAAGAATCCACAA pLKO.1 1184 CDS 100% 4.050 5.670 N RGS6 n/a
2 TRCN0000014319 GCTATGAGATAACCAGTCAAA pLKO.1 1740 CDS 100% 4.950 3.960 N RGS6 n/a
3 TRCN0000014322 GCTTCTCTTTCGATGAGATAT pLKO.1 1524 CDS 100% 13.200 9.240 N RGS6 n/a
4 TRCN0000014321 GCATGTACTCAGCCAACCAAT pLKO.1 1261 CDS 100% 4.950 3.465 N RGS6 n/a
5 TRCN0000037146 GCTTATGAAGAACCTTTCCAT pLKO.1 727 CDS 100% 3.000 2.100 N Rgs6 n/a
6 TRCN0000037148 GCTGATGAAGAGTGACAGCTA pLKO.1 1816 CDS 100% 2.640 1.848 N Rgs6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021825.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02214 pDONR223 100% 97% 96.6% None (many diffs) n/a
2 ccsbBroad304_02214 pLX_304 0% 97% 96.6% V5 (many diffs) n/a
3 TRCN0000478246 ACGGACACCTGCAACTGCCCTCCG pLX_317 20.7% 97% 96.6% V5 (many diffs) n/a
Download CSV