Transcript: Human XM_017021911.1

PREDICTED: Homo sapiens LEO1 homolog, Paf1/RNA polymerase II complex component (LEO1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LEO1 (123169)
Length:
2211
CDS:
54..1982

Additional Resources:

NCBI RefSeq record:
XM_017021911.1
NBCI Gene record:
LEO1 (123169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008732 CGCCGAGATGAAGAAGGAAAT pLKO.1 1326 CDS 100% 10.800 15.120 N LEO1 n/a
2 TRCN0000329745 CGCCGAGATGAAGAAGGAAAT pLKO_005 1326 CDS 100% 10.800 15.120 N LEO1 n/a
3 TRCN0000008735 CCAAGTAATAAGGAACTGTTT pLKO.1 219 CDS 100% 4.950 6.930 N LEO1 n/a
4 TRCN0000329685 CCAAGTAATAAGGAACTGTTT pLKO_005 219 CDS 100% 4.950 6.930 N LEO1 n/a
5 TRCN0000329746 GATTTAGGAAACGACTTATAT pLKO_005 1155 CDS 100% 15.000 10.500 N LEO1 n/a
6 TRCN0000008736 CCTCAGTATTATGAAGATGAA pLKO.1 1224 CDS 100% 4.950 3.465 N LEO1 n/a
7 TRCN0000008733 GCAAAGAAACTTACCAGTGAT pLKO.1 1926 CDS 100% 4.950 3.465 N LEO1 n/a
8 TRCN0000008734 GCTGAGCGTAAAGATTCTGAT pLKO.1 99 CDS 100% 4.950 3.465 N LEO1 n/a
9 TRCN0000329743 GCTGAGCGTAAAGATTCTGAT pLKO_005 99 CDS 100% 4.950 3.465 N LEO1 n/a
10 TRCN0000150618 GAAGAGGAAGAAGATGATGAT pLKO.1 2056 3UTR 100% 4.950 2.475 Y SAMD1 n/a
11 TRCN0000431954 AGAGGAAGAAGATGATGATTA pLKO_005 2058 3UTR 100% 13.200 6.600 Y Ssxb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021911.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04770 pDONR223 100% 95.9% 94% None (many diffs) n/a
2 ccsbBroad304_04770 pLX_304 0% 95.9% 94% V5 (many diffs) n/a
3 TRCN0000476344 TTCCGTGATGCGAGACGAATTCGC pLX_317 18.8% 95.9% 94% V5 (many diffs) n/a
Download CSV