Transcript: Human XM_017021916.1

PREDICTED: Homo sapiens transmembrane protein 266 (TMEM266), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM266 (123591)
Length:
2561
CDS:
870..1913

Additional Resources:

NCBI RefSeq record:
XM_017021916.1
NBCI Gene record:
TMEM266 (123591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172738 GTCAGTATTACAATGGGCCCA pLKO.1 1312 CDS 100% 0.540 0.756 N TMEM266 n/a
2 TRCN0000263929 TACCAAAGAGAAGGGTCTAAC pLKO_005 637 5UTR 100% 0.000 0.000 N TMEM266 n/a
3 TRCN0000282861 CCATCTGAGCCTATGTCATTT pLKO_005 2367 3UTR 100% 13.200 9.240 N TMEM266 n/a
4 TRCN0000263930 CCAACAAGTAGACGAAGAAAC pLKO_005 504 5UTR 100% 10.800 7.560 N TMEM266 n/a
5 TRCN0000263928 GCTGTGATCATCCTATCTTTG pLKO_005 843 5UTR 100% 10.800 7.560 N TMEM266 n/a
6 TRCN0000127290 CCCAACAAGTAGACGAAGAAA pLKO.1 503 5UTR 100% 5.625 3.938 N Tmem266 n/a
7 TRCN0000172768 CTTTCAGATCAGGCCTGTCAT pLKO.1 1802 CDS 100% 4.950 3.465 N TMEM266 n/a
8 TRCN0000172791 GAGATGGTTATCCAGCAGTAC pLKO.1 999 CDS 100% 4.050 2.835 N TMEM266 n/a
9 TRCN0000282862 CTGGAGATGGAGATGGTTATC pLKO_005 990 CDS 100% 10.800 6.480 N TMEM266 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13099 pDONR223 100% 99.8% 99.4% None 620G>A;728C>T n/a
2 ccsbBroad304_13099 pLX_304 0% 99.8% 99.4% V5 620G>A;728C>T n/a
3 TRCN0000476039 CAAACCTATGCTATCACAATCCCT pLX_317 28.1% 99.8% 99.4% V5 620G>A;728C>T n/a
Download CSV