Transcript: Human XM_017022025.2

PREDICTED: Homo sapiens acyl-CoA synthetase bubblegum family member 1 (ACSBG1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSBG1 (23205)
Length:
3215
CDS:
61..2307

Additional Resources:

NCBI RefSeq record:
XM_017022025.2
NBCI Gene record:
ACSBG1 (23205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000112513 GCGCCTCAAAGAATTAATCAT pLKO.1 1752 CDS 100% 5.625 7.875 N Acsbg1 n/a
2 TRCN0000150785 GCGCCTCAAAGAATTAATCAT pLKO.1 1752 CDS 100% 5.625 7.875 N ACSBG1 n/a
3 TRCN0000157553 GCTGTGTGCTAGTCTACACTT pLKO.1 887 CDS 100% 4.950 3.960 N ACSBG1 n/a
4 TRCN0000157552 GCCAGTACATCGCTTATGACT pLKO.1 647 CDS 100% 3.000 2.400 N ACSBG1 n/a
5 TRCN0000157807 CATGTCCAGTCCCTACAACTA pLKO.1 1512 CDS 100% 4.950 3.465 N ACSBG1 n/a
6 TRCN0000154174 CATATTCATGGGCTACCTGAA pLKO.1 1632 CDS 100% 4.050 2.835 N ACSBG1 n/a
7 TRCN0000150517 GAGATCATAGAGAAGAAGGAT pLKO.1 2002 CDS 100% 3.000 2.100 N ACSBG1 n/a
8 TRCN0000156616 GAACACATCTCCTACTCCCAA pLKO.1 451 CDS 100% 2.640 1.848 N ACSBG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022025.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489458 GCCGTTAGCATGGAGTTATCGAAG pLX_317 19.3% 95.8% 95.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489202 CGCCCACATCTTCGGCGATACCAG pLX_317 14.5% 95.8% 93.8% V5 (many diffs) n/a
3 ccsbBroadEn_07854 pDONR223 100% 95.5% 95.1% None (many diffs) n/a
4 ccsbBroad304_07854 pLX_304 0% 95.5% 95.1% V5 (many diffs) n/a
5 TRCN0000481289 GGCCCAGGGAAACAACGAGGCACC pLX_317 22.2% 95.5% 95.1% V5 (many diffs) n/a
6 ccsbBroadEn_10792 pDONR223 100% 3.9% 1.2% None (many diffs) n/a
7 ccsbBroad304_10792 pLX_304 0% 3.9% 1.2% V5 (many diffs) n/a
8 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 3.9% 1.2% V5 (many diffs) n/a
Download CSV