Transcript: Human XM_017022413.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase 1 (MAP2K1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2K1 (5604)
Length:
2654
CDS:
1072..1725

Additional Resources:

NCBI RefSeq record:
XM_017022413.1
NBCI Gene record:
MAP2K1 (5604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199799 GTCCTACATGTCGCCAGAAAG pLKO.1 1224 CDS 100% 10.800 15.120 N MAP2K1 n/a
2 TRCN0000344506 GTCCTACATGTCGCCAGAAAG pLKO_005 1224 CDS 100% 10.800 15.120 N MAP2K1 n/a
3 TRCN0000002332 GATTACATAGTCAACGAGCCT pLKO.1 1486 CDS 100% 0.660 0.924 N MAP2K1 n/a
4 TRCN0000002330 CTGATGCTGAGGAAGTGGATT pLKO.1 1634 CDS 100% 4.950 3.465 N MAP2K1 n/a
5 TRCN0000195621 CCCATATCCAAGTACCAATGC pLKO.1 2501 3UTR 100% 4.050 2.835 N MAP2K1 n/a
6 TRCN0000219685 TTGACATTTGGTGGTACTTTA pLKO.1 2091 3UTR 100% 13.200 7.920 N MAP2K1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022413.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_14807 pLX_304 50.7% 53.3% 1.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14807 pDONR223 100% 53.3% 1.6% None (many diffs) n/a
3 TRCN0000492332 GTGTTATTTGGCCTAAGAGCTCAC pLX_317 33.1% 53.3% 51.5% V5 (many diffs) n/a
4 ccsbBroadEn_16176 pDONR223 0% 53% 51.1% None (many diffs) n/a
5 ccsbBroad304_16176 pLX_304 0% 53% 51.1% V5 (many diffs) n/a
Download CSV