Transcript: Human XM_017022429.1

PREDICTED: Homo sapiens DTW domain containing 1 (DTWD1), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DTWD1 (56986)
Length:
7935
CDS:
1427..2080

Additional Resources:

NCBI RefSeq record:
XM_017022429.1
NBCI Gene record:
DTWD1 (56986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134352 GTATCCGTGTATTCCAGAATA pLKO.1 1534 CDS 100% 13.200 18.480 N DTWD1 n/a
2 TRCN0000134250 CCTATTGAACAGATTCCACTT pLKO.1 1168 5UTR 100% 4.050 5.670 N DTWD1 n/a
3 TRCN0000134120 CCAGTTGATAAAGAATGCCAA pLKO.1 2020 CDS 100% 2.640 3.696 N DTWD1 n/a
4 TRCN0000133978 CATTTACACGTATCCGTGTAT pLKO.1 1525 CDS 100% 0.495 0.693 N DTWD1 n/a
5 TRCN0000135278 CGACTTCAAGGGTTGTTACAA pLKO.1 1823 CDS 100% 5.625 3.938 N DTWD1 n/a
6 TRCN0000135971 GACCATGAAGTTGCACTCATT pLKO.1 1565 CDS 100% 4.950 3.465 N DTWD1 n/a
7 TRCN0000134974 CCAAATGAAACAGATGGCAAA pLKO.1 1460 CDS 100% 4.050 2.835 N DTWD1 n/a
8 TRCN0000133909 CACAAACTACTTCCATAGCTT pLKO.1 1004 5UTR 100% 3.000 2.100 N DTWD1 n/a
9 TRCN0000133640 GAAGAACAAGAGTTCTGTGAT pLKO.1 1709 CDS 100% 0.495 0.297 N DTWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03765 pDONR223 100% 71.2% 71% None 0_1ins261;2T>A n/a
2 ccsbBroad304_03765 pLX_304 0% 71.2% 71% V5 0_1ins261;2T>A n/a
3 TRCN0000474092 CTTGTTATAGCTAGCCTAGTGGTT pLX_317 59.1% 71.1% 19% V5 (not translated due to prior stop codon) 0_1ins261;2T>A;157_158insT n/a
Download CSV