Transcript: Human XM_017022570.1

PREDICTED: Homo sapiens leucine rich repeat kinase 1 (LRRK1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRK1 (79705)
Length:
6643
CDS:
80..4654

Additional Resources:

NCBI RefSeq record:
XM_017022570.1
NBCI Gene record:
LRRK1 (79705)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380192 TCTACTTCCTCGACCCTATTT pLKO_005 1362 CDS 100% 13.200 18.480 N LRRK1 n/a
2 TRCN0000007041 CGGTGGAGATGTTATCGTCAT pLKO.1 4378 CDS 100% 4.050 5.670 N LRRK1 n/a
3 TRCN0000350494 CGGTGGAGATGTTATCGTCAT pLKO_005 4378 CDS 100% 4.050 5.670 N LRRK1 n/a
4 TRCN0000199833 GCCGAGTCATTGCCGTCTTAA pLKO.1 4431 CDS 100% 13.200 10.560 N LRRK1 n/a
5 TRCN0000315173 ACACCATTCAGAGGGTATTTA pLKO_005 1641 CDS 100% 15.000 10.500 N LRRK1 n/a
6 TRCN0000007038 CCCAGGTCTCAGATGGAATTA pLKO.1 5021 3UTR 100% 13.200 9.240 N LRRK1 n/a
7 TRCN0000315172 CCCAGGTCTCAGATGGAATTA pLKO_005 5021 3UTR 100% 13.200 9.240 N LRRK1 n/a
8 TRCN0000007039 CGCCAGAGATTCTTCCTTTAT pLKO.1 2653 CDS 100% 13.200 9.240 N LRRK1 n/a
9 TRCN0000315171 CGCCAGAGATTCTTCCTTTAT pLKO_005 2653 CDS 100% 13.200 9.240 N LRRK1 n/a
10 TRCN0000007040 CCAACACCATTCAGAGGGTAT pLKO.1 1638 CDS 100% 4.050 2.835 N LRRK1 n/a
11 TRCN0000007042 CCTGGATTTAATTGAAGCCAA pLKO.1 880 CDS 100% 2.640 1.848 N LRRK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489245 CTGCCTTATAAACTAAGGTCTGGC pLX_317 7.1% 85.9% 85.9% V5 (not translated due to prior stop codon) 1_642del;1974A>G n/a
2 TRCN0000489672 GCTATGCTTATTTCGCATCCGCTT pLX_317 8% 85.9% 85.9% V5 1_642del;1974A>G;4572_4573insG n/a
Download CSV