Transcript: Human XM_017022685.1

PREDICTED: Homo sapiens cingulin like 1 (CGNL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CGNL1 (84952)
Length:
7858
CDS:
714..4625

Additional Resources:

NCBI RefSeq record:
XM_017022685.1
NBCI Gene record:
CGNL1 (84952)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139679 CGCTACGCTGATGTTACAGAA pLKO.1 2216 CDS 100% 4.950 6.930 N CGNL1 n/a
2 TRCN0000217916 GACTTAAAGAGCCGGATTATC pLKO.1 4095 CDS 100% 13.200 10.560 N Cgnl1 n/a
3 TRCN0000428067 GGACTTAAAGAGCCGGATTAT pLKO_005 4094 CDS 100% 13.200 10.560 N CGNL1 n/a
4 TRCN0000139626 CATCTGAGACTCGCAAGTGAT pLKO.1 765 CDS 100% 4.950 3.960 N CGNL1 n/a
5 TRCN0000140917 CTGAAGAAGCTGCCGAGTAAA pLKO.1 4491 CDS 100% 13.200 9.240 N CGNL1 n/a
6 TRCN0000140784 GCAGACCTCAGTGTGTGTAAA pLKO.1 1400 CDS 100% 13.200 9.240 N CGNL1 n/a
7 TRCN0000437556 TATGCAGCTCCGTGGTCATAG pLKO_005 1366 CDS 100% 10.800 7.560 N CGNL1 n/a
8 TRCN0000140338 CCATCTCACCTGCTGAACTTT pLKO.1 1128 CDS 100% 5.625 3.938 N CGNL1 n/a
9 TRCN0000139202 CAGCCGAACATAGATGGGAAA pLKO.1 2100 CDS 100% 4.050 2.835 N CGNL1 n/a
10 TRCN0000141906 GCACTGATAATGACGATGCTA pLKO.1 2413 CDS 100% 3.000 2.100 N CGNL1 n/a
11 TRCN0000139825 CAAGGACTTAAAGAGCCGGAT pLKO.1 4091 CDS 100% 2.160 1.512 N CGNL1 n/a
12 TRCN0000182290 GAGGAGAATGAGAAGCTGCTA pLKO.1 3198 CDS 100% 2.640 1.584 N Ccdc155 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022685.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09246 pDONR223 100% 99.8% 99.6% None (many diffs) n/a
2 ccsbBroad304_09246 pLX_304 0% 99.8% 99.6% V5 (many diffs) n/a
3 TRCN0000479275 TCCGCGGCCGAGTAGCCTACCATA pLX_317 10.1% 99.8% 99.6% V5 (many diffs) n/a
Download CSV