Transcript: Human XM_017022883.1

PREDICTED: Homo sapiens PR/SET domain 7 (PRDM7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRDM7 (11105)
Length:
1644
CDS:
295..1554

Additional Resources:

NCBI RefSeq record:
XM_017022883.1
NBCI Gene record:
PRDM7 (11105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022883.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358480 GAATCAGGAGCGGCAATATTC pLKO_005 1469 CDS 100% 13.200 7.920 N PRDM7 n/a
2 TRCN0000358508 AGTGGATATTCCTGGCTAATC pLKO_005 940 CDS 100% 10.800 6.480 N PRDM7 n/a
3 TRCN0000015174 CAGTGGATATTCCTGGCTAAT pLKO.1 939 CDS 100% 10.800 6.480 N PRDM7 n/a
4 TRCN0000015176 GCTATGAGTATGTGGATGGAA pLKO.1 977 CDS 100% 3.000 1.500 Y PRDM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022883.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02621 pDONR223 100% 40.8% 29.2% None 1_399del;729_1011del;1196_1257del n/a
2 ccsbBroad304_02621 pLX_304 0% 40.8% 29.2% V5 1_399del;729_1011del;1196_1257del n/a
3 TRCN0000491630 GCTATCAAATGTTTGTGAAGCGCC pLX_317 64.9% 40.8% 29.2% V5 1_399del;729_1011del;1196_1257del n/a
Download CSV