Transcript: Human XM_017023022.1

PREDICTED: Homo sapiens acyl-CoA synthetase family member 3 (ACSF3), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSF3 (197322)
Length:
1769
CDS:
703..1668

Additional Resources:

NCBI RefSeq record:
XM_017023022.1
NBCI Gene record:
ACSF3 (197322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231120 ACCCTCCGTGTTTCGAGAATA pLKO_005 1122 CDS 100% 13.200 10.560 N ACSF3 n/a
2 TRCN0000157714 CATCAAGACTGGAGGCTACAA pLKO.1 1263 CDS 100% 4.950 3.465 N ACSF3 n/a
3 TRCN0000157272 GATGTGGCTGTGATTGGAGTT pLKO.1 1336 CDS 100% 4.050 2.835 N ACSF3 n/a
4 TRCN0000156574 GTGGACATCATCAAGACTGGA pLKO.1 1255 CDS 100% 2.640 1.848 N ACSF3 n/a
5 TRCN0000156424 CATCATCAAGACTGGAGGCTA pLKO.1 1260 CDS 100% 2.640 1.584 N ACSF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09794 pDONR223 100% 38.4% 27% None (many diffs) n/a
2 ccsbBroad304_09794 pLX_304 0% 38.4% 27% V5 (many diffs) n/a
3 TRCN0000477630 CGCGGCACAGGGACTCTTGGTCTT pLX_317 22.2% 38.4% 27% V5 (many diffs) n/a
Download CSV