Transcript: Human XM_017023024.1

PREDICTED: Homo sapiens WD repeat domain 90 (WDR90), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR90 (197335)
Length:
3428
CDS:
329..3184

Additional Resources:

NCBI RefSeq record:
XM_017023024.1
NBCI Gene record:
WDR90 (197335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433626 AGTGCACCTGTGCAGGTTTAC pLKO_005 3094 CDS 100% 10.800 7.560 N WDR90 n/a
2 TRCN0000122726 CCAGGTTGTCAATGGCCTCAT pLKO.1 3260 3UTR 100% 4.050 2.430 N WDR90 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13376 pDONR223 100% 30.6% 27.9% None (many diffs) n/a
2 ccsbBroad304_13376 pLX_304 0% 30.6% 27.9% V5 (many diffs) n/a
3 TRCN0000469226 GATCTCTTAAACCATCCATGTATC pLX_317 47.3% 30.6% 27.9% V5 (many diffs) n/a
Download CSV