Transcript: Human XM_017023276.1

PREDICTED: Homo sapiens 3-phosphoinositide dependent protein kinase 1 (PDPK1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDPK1 (5170)
Length:
7178
CDS:
93..1412

Additional Resources:

NCBI RefSeq record:
XM_017023276.1
NBCI Gene record:
PDPK1 (5170)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221540 CCTTGGCACCAGTTTGTAGAA pLKO.1 1050 CDS 100% 4.950 6.930 N PDPK1 n/a
2 TRCN0000010414 GATAAGCGGAAGGGTTTATTT pLKO.1 1101 CDS 100% 15.000 10.500 N PDPK1 n/a
3 TRCN0000234792 GGATAAGCGGAAGGGTTTATT pLKO_005 1100 CDS 100% 15.000 10.500 N PDPK1 n/a
4 TRCN0000234795 TATAGACTCAGAAGGTATATT pLKO_005 5574 3UTR 100% 15.000 10.500 N PDPK1 n/a
5 TRCN0000238781 AGGACTGCTATGGCAATTATG pLKO_005 820 CDS 100% 13.200 9.240 N PDPK1 n/a
6 TRCN0000221541 CAAAGTTCTGAAAGGTGAAAT pLKO.1 1184 CDS 100% 13.200 9.240 N PDPK1 n/a
7 TRCN0000001480 TCGACCAGAGGCCAAGAATTT pLKO.1 1223 CDS 100% 13.200 9.240 N PDPK1 n/a
8 TRCN0000234793 TCGACCAGAGGCCAAGAATTT pLKO_005 1223 CDS 100% 13.200 9.240 N PDPK1 n/a
9 TRCN0000196433 GAAGGTATATTAGGACATTTG pLKO.1 5584 3UTR 100% 10.800 7.560 N PDPK1 n/a
10 TRCN0000010413 CAACATAGAGCAGTACATTCA pLKO.1 941 CDS 100% 4.950 3.465 N PDPK1 n/a
11 TRCN0000221539 CGAAGATGAGAAGAGGTTGTT pLKO.1 1004 CDS 100% 4.950 3.465 N PDPK1 n/a
12 TRCN0000001476 GCAGCAACATAGAGCAGTACA pLKO.1 937 CDS 100% 4.950 3.465 N PDPK1 n/a
13 TRCN0000001478 AGTGGATAAGCGGAAGGGTTT pLKO.1 1097 CDS 100% 4.050 2.835 N PDPK1 n/a
14 TRCN0000001479 CGGAAGGGTTTATTTGCAAGA pLKO.1 1107 CDS 100% 4.050 2.835 N PDPK1 n/a
15 TRCN0000195195 CAGAAGATCATTAAGTTGGAA pLKO.1 585 CDS 100% 3.000 2.100 N PDPK2P n/a
16 TRCN0000001477 TCACAGAAGGACCACATTTAT pLKO.1 1144 CDS 100% 15.000 9.000 N PDPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01168 pDONR223 100% 92.4% 87.3% None (many diffs) n/a
2 ccsbBroad304_01168 pLX_304 31.2% 92% 86.7% V5 (many diffs) n/a
3 ccsbBroadEn_14741 pDONR223 0% 92.4% 87.3% None (many diffs) n/a
4 ccsbBroad304_14741 pLX_304 41.3% 92.4% 87.3% V5 (many diffs) n/a
5 TRCN0000480980 CAGTAGTGACAATACTGCTATGTA pLX_317 36% 92.4% 87.3% V5 (many diffs) n/a
6 TRCN0000487873 CCTTACGAGACCCGGGACGTAGGT pLX_317 17.3% 72% 68% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000487875 ACAAACAGTCCTGGGTGGCTTGGC pLX_317 19.2% 72% 69.2% V5 (many diffs) n/a
Download CSV