Transcript: Human XM_017023399.2

PREDICTED: Homo sapiens solute carrier family 38 member 7 (SLC38A7), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC38A7 (55238)
Length:
1236
CDS:
394..1149

Additional Resources:

NCBI RefSeq record:
XM_017023399.2
NBCI Gene record:
SLC38A7 (55238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418139 GTACGTCACAGCCATCGTTAT pLKO_005 1029 CDS 100% 10.800 15.120 N SLC38A7 n/a
2 TRCN0000060156 GACCAGCAGGACAAGATTATA pLKO.1 847 CDS 100% 15.000 10.500 N SLC38A7 n/a
3 TRCN0000060154 CCCTTGGTACACAGACCGCAA pLKO.1 903 CDS 100% 0.720 0.504 N SLC38A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023399.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03558 pDONR223 100% 52.9% 50.1% None (many diffs) n/a
2 ccsbBroad304_03558 pLX_304 0% 52.9% 50.1% V5 (many diffs) n/a
3 TRCN0000468239 CTGATCCGCTGCAACAGCATCTCA pLX_317 34.9% 52.9% 50.1% V5 (many diffs) n/a
Download CSV