Transcript: Human XM_017023458.1

PREDICTED: Homo sapiens ALG1 chitobiosyldiphosphodolichol beta-mannosyltransferase (ALG1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALG1 (56052)
Length:
2071
CDS:
497..1558

Additional Resources:

NCBI RefSeq record:
XM_017023458.1
NBCI Gene record:
ALG1 (56052)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438260 GTGGAAGCAAGCTCGTCATTG pLKO_005 606 CDS 100% 10.800 8.640 N ALG1 n/a
2 TRCN0000439877 GAGAAGACCTGGCGGATAACT pLKO_005 762 CDS 100% 5.625 4.500 N ALG1 n/a
3 TRCN0000035691 GCTCTTGCAGAACAACAGAAT pLKO.1 391 5UTR 100% 4.950 3.465 N ALG1 n/a
4 TRCN0000438113 TGGCCAAGTGGTACGAGAAGT pLKO_005 693 CDS 100% 4.950 3.465 N ALG1 n/a
5 TRCN0000035692 TGCCTATATCTTTCTCCAGAA pLKO.1 535 CDS 100% 4.050 2.835 N ALG1 n/a
6 TRCN0000035690 GCACAACTATGGCTACTCCAT pLKO.1 631 CDS 100% 2.640 1.848 N ALG1 n/a
7 TRCN0000437312 CCTTTCTGCCGTGTTCCTAAC pLKO_005 1880 3UTR 100% 6.000 3.600 N ALG1 n/a
8 TRCN0000035689 CCTGTGTGTTACCAATGCTAT pLKO.1 739 CDS 100% 4.950 2.970 N ALG1 n/a
9 TRCN0000437930 GAACTGAGTGTGTCCACGTTG pLKO_005 1984 3UTR 100% 4.050 2.430 N ALG1 n/a
10 TRCN0000262803 AGGGCCTCTGAGGGAGTATTA pLKO_005 1129 CDS 100% 13.200 6.600 Y ALG1L2 n/a
11 TRCN0000035128 AGCTGGTGAAACATGAAGAAA pLKO.1 1359 CDS 100% 5.625 2.813 Y ALG1L6P n/a
12 TRCN0000035983 ACTGACTCTTGATGGACACAA pLKO.1 1075 CDS 100% 4.950 2.475 Y LOC401305 n/a
13 TRCN0000035693 CCCTTTGGTTATGGACACATA pLKO.1 1537 CDS 100% 4.950 2.475 Y ALG1 n/a
14 TRCN0000035858 GCTAAACCAGTTCCGGAAGAA pLKO.1 1462 CDS 100% 4.950 2.475 Y ALG1L9P n/a
15 TRCN0000036015 AGAGGACGAAGACTTCTCCAT pLKO.1 1024 CDS 100% 2.640 1.320 Y LOC402458 n/a
16 TRCN0000035126 CGTCTGTGTGATAACAGGCAA pLKO.1 1108 CDS 100% 2.640 1.320 Y ALG1L6P n/a
17 TRCN0000035857 CAGAGGACGAAGACTTCTCTA pLKO.1 1023 CDS 100% 4.950 2.475 Y ALG1L9P n/a
18 TRCN0000035979 CCTTCCTTCTCTCGTCTGTAT pLKO.1 1096 CDS 100% 4.950 2.475 Y LOC401305 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08617 pDONR223 100% 75.9% 75.6% None 0_1ins333;317A>G;467G>A n/a
2 ccsbBroad304_08617 pLX_304 0% 75.9% 75.6% V5 0_1ins333;317A>G;467G>A n/a
3 TRCN0000474781 GTTGTCATAGGATTGTCCTTGGGT pLX_317 41.7% 75.9% 75.6% V5 0_1ins333;317A>G;467G>A n/a
4 ccsbBroadEn_09808 pDONR223 100% 40% 38.3% None (many diffs) n/a
5 ccsbBroad304_09808 pLX_304 0% 40% 38.3% V5 (many diffs) n/a
6 TRCN0000473899 GTAAGTGAACCTTCGCATAACGTG pLX_317 73.6% 40% 38.3% V5 (many diffs) n/a
Download CSV