Transcript: Human XM_017023507.2

PREDICTED: Homo sapiens RAN binding protein 10 (RANBP10), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RANBP10 (57610)
Length:
2461
CDS:
183..1493

Additional Resources:

NCBI RefSeq record:
XM_017023507.2
NBCI Gene record:
RANBP10 (57610)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232573 CCGGGAGTACGGCAAGAATTT pLKO_005 1208 CDS 100% 13.200 18.480 N RANBP10 n/a
2 TRCN0000232572 GGAAGAACAGGCGTCCATAAA pLKO_005 488 CDS 100% 13.200 18.480 N RANBP10 n/a
3 TRCN0000232571 CCTCGTGCATCATGGGTATTG pLKO_005 422 CDS 100% 10.800 15.120 N RANBP10 n/a
4 TRCN0000232574 CAAGTTGGTGATAGCTTATTA pLKO_005 1885 3UTR 100% 15.000 10.500 N RANBP10 n/a
5 TRCN0000232570 AGATTGTGGACGCCAACTTTG pLKO_005 262 CDS 100% 10.800 7.560 N RANBP10 n/a
6 TRCN0000178731 CCTGTTTGACATTGAGGACTA pLKO.1 296 CDS 100% 4.050 2.835 N RANBP10 n/a
7 TRCN0000102097 CGTCAATTACTCCGAGTCCAA pLKO.1 905 CDS 100% 2.640 1.848 N Ranbp10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023507.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15950 pDONR223 0% 70.3% 67.8% None 0_1ins529;38_39ins23 n/a
2 ccsbBroad304_15950 pLX_304 0% 70.3% 67.8% V5 0_1ins529;38_39ins23 n/a
3 TRCN0000471832 AGCAGACGTTGCATGCGCAATTCA pLX_317 24.5% 67.7% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV