Transcript: Human XM_017023733.1

PREDICTED: Homo sapiens c-Maf inducing protein (CMIP), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CMIP (80790)
Length:
8702
CDS:
4979..6739

Additional Resources:

NCBI RefSeq record:
XM_017023733.1
NBCI Gene record:
CMIP (80790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365125 GAACCTTTGACCTGATCTAAA pLKO_005 6949 3UTR 100% 13.200 9.240 N CMIP n/a
2 TRCN0000376590 TCATCAACAGCCGCGACAATT pLKO_005 5442 CDS 100% 13.200 9.240 N CMIP n/a
3 TRCN0000346430 AGGAACTGAAGTACGTGATTC pLKO_005 5898 CDS 100% 10.800 7.560 N Cmip n/a
4 TRCN0000370141 AGGAACTGAAGTACGTGATTC pLKO_005 5898 CDS 100% 10.800 7.560 N CMIP n/a
5 TRCN0000377460 TCAAGCTGCTGTCAGACTATG pLKO_005 5796 CDS 100% 10.800 7.560 N CMIP n/a
6 TRCN0000118480 GCGAATCCTCAAGCATAACAT pLKO.1 5221 CDS 100% 5.625 3.938 N CMIP n/a
7 TRCN0000118478 CCACTGGAAATCGTCTCGAAA pLKO.1 5024 CDS 100% 4.950 3.465 N CMIP n/a
8 TRCN0000118477 GCCTCTTATTTATGAAGTCTT pLKO.1 7321 3UTR 100% 4.950 3.465 N CMIP n/a
9 TRCN0000118481 CCTCAAGCATAACATGGACTT pLKO.1 5227 CDS 100% 4.050 2.835 N CMIP n/a
10 TRCN0000118479 GCCAGTTTGCTTCAACCCATT pLKO.1 5837 CDS 100% 4.050 2.835 N CMIP n/a
11 TRCN0000377359 ATTCAAGCATGACAGCATTTC pLKO_005 4459 5UTR 100% 10.800 5.400 Y AHRR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12708 pDONR223 100% 94.5% 94.5% None 0_1ins102 n/a
2 ccsbBroad304_12708 pLX_304 0% 94.5% 94.5% V5 0_1ins102 n/a
3 TRCN0000481437 TGCCCATGACCGTGTGCATCAACT pLX_317 28.8% 94.5% 94.5% V5 0_1ins102 n/a
Download CSV