Transcript: Human XM_017024107.1

PREDICTED: Homo sapiens transmembrane channel like 6 (TMC6), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMC6 (11322)
Length:
2703
CDS:
236..2473

Additional Resources:

NCBI RefSeq record:
XM_017024107.1
NBCI Gene record:
TMC6 (11322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119004 TCACTCCATCTACGAGAGGAA pLKO.1 2368 CDS 100% 2.640 2.112 N TMC6 n/a
2 TRCN0000436891 CGCCTCCAGCAGGACAATATT pLKO_005 1427 CDS 100% 15.000 10.500 N TMC6 n/a
3 TRCN0000414254 ATGTCCTGGAGCTGATTTATG pLKO_005 1830 CDS 100% 13.200 9.240 N TMC6 n/a
4 TRCN0000119002 CCAGGACAAGGAAGACAGTTT pLKO.1 2552 3UTR 100% 4.950 3.465 N TMC6 n/a
5 TRCN0000119003 CGTCATGTACTACGGCCACTA pLKO.1 1144 CDS 100% 4.050 2.835 N TMC6 n/a
6 TRCN0000119005 GAGCTTCTTTATCACCTGCAT pLKO.1 1282 CDS 100% 2.640 1.848 N TMC6 n/a
7 TRCN0000119006 CTGCTCACAGATGAACAGGAT pLKO.1 2447 CDS 100% 2.640 1.584 N TMC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11621 pDONR223 100% 47.7% 47.7% None 1_1083del;1533_1534ins180 n/a
2 ccsbBroad304_11621 pLX_304 0% 47.7% 47.7% V5 1_1083del;1533_1534ins180 n/a
3 TRCN0000467470 GATCCCGCGACTGGTCAGGGAGGG pLX_317 28.5% 47.7% 47.7% V5 1_1083del;1533_1534ins180 n/a
4 ccsbBroadEn_11622 pDONR223 100% 25.6% 20.8% None (many diffs) n/a
5 ccsbBroad304_11622 pLX_304 0% 25.6% 20.8% V5 (many diffs) n/a
6 TRCN0000481404 AAGCACCGAATTTTGCACCAGTCC pLX_317 36.7% 25.6% 20.8% V5 (many diffs) n/a
Download CSV