Transcript: Human XM_017024418.2

PREDICTED: Homo sapiens TBC1 domain family member 28 (TBC1D28), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D28 (254272)
Length:
3889
CDS:
1670..2722

Additional Resources:

NCBI RefSeq record:
XM_017024418.2
NBCI Gene record:
TBC1D28 (254272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245872 TCACCGTGTTTCATGCTATTT pLKO_005 2585 CDS 100% 13.200 9.240 N TBC1D28 n/a
2 TRCN0000118514 CGTGGCCTATTCTGCATATAA pLKO.1 2314 CDS 100% 15.000 7.500 Y TBC1D26 n/a
3 TRCN0000118515 CCCAGGCAAATATAAGGTCAT pLKO.1 2164 CDS 100% 4.050 2.025 Y TBC1D26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024418.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10062 pDONR223 100% 60.3% 45.8% None (many diffs) n/a
2 ccsbBroad304_10062 pLX_304 0% 60.3% 45.8% V5 (many diffs) n/a
3 TRCN0000471493 CACCGGATCCAACTCAATTTTTTG pLX_317 58.4% 60.3% 45.8% V5 (many diffs) n/a
4 ccsbBroadEn_09898 pDONR223 100% 54% 48% None (many diffs) n/a
5 ccsbBroad304_09898 pLX_304 0% 54% 48% V5 (many diffs) n/a
6 TRCN0000477885 TTTCCCCCCGACATGCCATGGAAT pLX_317 50.5% 54% 48% V5 (many diffs) n/a
Download CSV