Transcript: Human XM_017024697.1

PREDICTED: Homo sapiens olfactory receptor family 3 subfamily A member 2 (OR3A2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OR3A2 (4995)
Length:
3482
CDS:
654..1625

Additional Resources:

NCBI RefSeq record:
XM_017024697.1
NBCI Gene record:
OR3A2 (4995)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357843 CACTGTTATCAACCCTATGCT pLKO_005 1520 CDS 100% 3.000 4.200 N OR3A2 n/a
2 TRCN0000357842 TTCAGTGGAGGGCCGAAAGAA pLKO_005 1373 CDS 100% 5.625 3.938 N OR3A2 n/a
3 TRCN0000357916 AGAGGTATCTTCAACTACATG pLKO_005 1446 CDS 100% 4.950 3.465 N OR3A2 n/a
4 TRCN0000357844 AGGAGGCTTCAGACAAGGATA pLKO_005 1480 CDS 100% 4.950 3.465 N OR3A2 n/a
5 TRCN0000009396 AGGCACACCTTTGGTTCTCAT pLKO.1 1307 CDS 100% 4.950 3.465 N OR3A2 n/a
6 TRCN0000009394 CTGCAGTTCTACGAATCCGTT pLKO.1 1354 CDS 100% 2.640 1.848 N OR3A2 n/a
7 TRCN0000357841 ATCATGGCAGGCACACCTTTG pLKO_005 1299 CDS 100% 6.000 3.600 N OR3A2 n/a
8 TRCN0000009393 CTTTGGAAGAGGTATCTTCAA pLKO.1 1439 CDS 100% 0.495 0.297 N OR3A2 n/a
9 TRCN0000009400 GCTGTTGCTGAGTTCATTCTA pLKO.1 708 CDS 100% 5.625 2.813 Y OR3A3 n/a
10 TRCN0000009398 CCTAGTGCAAACAGAAGAGAT pLKO.1 734 CDS 100% 4.950 2.475 Y OR3A3 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2389 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000188431 CTCAATGAGCTGCTGCTCTTT pLKO.1 1266 CDS 100% 4.950 2.475 Y Olfr411 n/a
13 TRCN0000009392 CCACAAGTCCACAATTTCCTA pLKO.1 947 CDS 100% 3.000 1.500 Y OR3A2 n/a
14 TRCN0000009395 GCCGTCTTGGTGGAGCCCAAA pLKO.1 828 CDS 100% 0.000 0.000 Y OR3A2 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2390 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000009391 GCCAGTTGTCTTTGTGCTCTT pLKO.1 758 CDS 100% 4.050 2.025 Y OR3A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01124 pDONR223 100% 82.7% 79.2% None (many diffs) n/a
2 ccsbBroad304_01124 pLX_304 0% 82.7% 79.2% V5 (many diffs) n/a
3 TRCN0000473068 CCAGCTACATCAAGATTACCTAGT pLX_317 42.9% 82.7% 79.2% V5 (many diffs) n/a
Download CSV