Transcript: Human XM_017024808.1

PREDICTED: Homo sapiens WD repeat domain, phosphoinositide interacting 1 (WIPI1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WIPI1 (55062)
Length:
3890
CDS:
2442..3398

Additional Resources:

NCBI RefSeq record:
XM_017024808.1
NBCI Gene record:
WIPI1 (55062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156799 GCGGAAGAATGGAGTGCAATT pLKO.1 3464 3UTR 100% 10.800 8.640 N WIPI1 n/a
2 TRCN0000318870 GCGGAAGAATGGAGTGCAATT pLKO_005 3464 3UTR 100% 10.800 8.640 N WIPI1 n/a
3 TRCN0000152429 CGGGAGACATTGTATACACAT pLKO.1 3591 3UTR 100% 4.950 3.960 N WIPI1 n/a
4 TRCN0000318934 CGGGAGACATTGTATACACAT pLKO_005 3591 3UTR 100% 4.950 3.960 N WIPI1 n/a
5 TRCN0000157770 CGTGGAAATCAGAAGGGCAAA pLKO.1 3363 CDS 100% 4.050 3.240 N WIPI1 n/a
6 TRCN0000150944 GAGAATGAGTTTCCTCCTATA pLKO.1 3333 CDS 100% 10.800 7.560 N WIPI1 n/a
7 TRCN0000156280 CGAGACGGTACACATCTTCAA pLKO.1 2816 CDS 100% 4.950 3.465 N WIPI1 n/a
8 TRCN0000151454 CTCTCTATCAACCATTCCAAT pLKO.1 2499 CDS 100% 4.950 2.970 N WIPI1 n/a
9 TRCN0000318869 CTCTCTATCAACCATTCCAAT pLKO_005 2499 CDS 100% 4.950 2.970 N WIPI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08464 pDONR223 100% 71.3% 71.3% None 0_1ins384 n/a
2 ccsbBroad304_08464 pLX_304 0% 71.3% 71.3% V5 0_1ins384 n/a
3 TRCN0000468272 TAGGAACGCTTGAGGCACGTACTG pLX_317 30.6% 71.3% 71.3% V5 0_1ins384 n/a
Download CSV