Transcript: Human XM_017024896.2

PREDICTED: Homo sapiens nuclear FMR1 interacting protein 2 (NUFIP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUFIP2 (57532)
Length:
5881
CDS:
1863..3473

Additional Resources:

NCBI RefSeq record:
XM_017024896.2
NBCI Gene record:
NUFIP2 (57532)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024896.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172531 GACCCAATCATCAAGTCGCTT pLKO.1 2558 CDS 100% 2.640 3.696 N NUFIP2 n/a
2 TRCN0000349671 GACCCAATCATCAAGTCGCTT pLKO_005 2558 CDS 100% 2.640 3.696 N NUFIP2 n/a
3 TRCN0000167110 CGGTTACATATTGGACTTTAA pLKO.1 4212 3UTR 100% 13.200 9.240 N NUFIP2 n/a
4 TRCN0000349607 CGGTTACATATTGGACTTTAA pLKO_005 4212 3UTR 100% 13.200 9.240 N NUFIP2 n/a
5 TRCN0000167367 GAAACTTTCAAGCCTGACTAT pLKO.1 2160 CDS 100% 4.950 3.465 N NUFIP2 n/a
6 TRCN0000319179 GAAACTTTCAAGCCTGACTAT pLKO_005 2160 CDS 100% 4.950 3.465 N NUFIP2 n/a
7 TRCN0000166959 GAACAAATTAAGACTAGCCTT pLKO.1 2778 CDS 100% 2.640 1.584 N NUFIP2 n/a
8 TRCN0000349672 GAACAAATTAAGACTAGCCTT pLKO_005 2778 CDS 100% 2.640 1.584 N NUFIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024896.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03829 pDONR223 100% 77.1% 77.1% None 0_1ins477 n/a
2 ccsbBroad304_03829 pLX_304 0% 77.1% 77.1% V5 0_1ins477 n/a
3 TRCN0000480443 TAAGGCACTTAAGTCACGCAAGTC pLX_317 20.7% 77.1% 77.1% V5 0_1ins477 n/a
4 ccsbBroadEn_08741 pDONR223 100% 77% 77.1% None 0_1ins477;858C>T n/a
5 ccsbBroad304_08741 pLX_304 0% 77% 77.1% V5 0_1ins477;858C>T n/a
6 TRCN0000479286 AACAACTTCGGTCCGCAAACACTG pLX_317 16.7% 77% 77.1% V5 0_1ins477;858C>T n/a
Download CSV