Transcript: Human XM_017024905.2

PREDICTED: Homo sapiens ring finger protein 213 (RNF213), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF213 (57674)
Length:
16845
CDS:
266..15031

Additional Resources:

NCBI RefSeq record:
XM_017024905.2
NBCI Gene record:
RNF213 (57674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019041 CCTTACAAGTACGTCATTTAT pLKO.1 752 CDS 100% 15.000 21.000 N RNF213 n/a
2 TRCN0000151569 GCAAGAGATCTTTGGATGTTT pLKO.1 10388 CDS 100% 5.625 7.875 N RNF213 n/a
3 TRCN0000153221 GCCTCAGCTAAGTATTCTGTT pLKO.1 9581 CDS 100% 4.950 3.960 N RNF213 n/a
4 TRCN0000153317 GCCTTAAACAGATGCCAGTTA pLKO.1 14603 CDS 100% 4.950 3.960 N RNF213 n/a
5 TRCN0000153281 GCACAACTCCTTTGCAGATTT pLKO.1 9283 CDS 100% 13.200 9.240 N RNF213 n/a
6 TRCN0000019039 GCAGAATGATTAGACTTCTAT pLKO.1 2034 CDS 100% 5.625 3.938 N RNF213 n/a
7 TRCN0000153222 GCAGATGTGCAACAGTTTCTT pLKO.1 11593 CDS 100% 5.625 3.938 N RNF213 n/a
8 TRCN0000156905 GCTCTCGTCAGCTACTTGATT pLKO.1 14051 CDS 100% 5.625 3.938 N RNF213 n/a
9 TRCN0000151831 CCTGATTGTCATTGAAGAGAA pLKO.1 8848 CDS 100% 4.950 3.465 N RNF213 n/a
10 TRCN0000019043 CGATTTGCAGTACAGGGAGAA pLKO.1 1138 CDS 100% 4.050 2.835 N RNF213 n/a
11 TRCN0000157222 GCTGACAAGAAACACCCTGAA pLKO.1 11014 CDS 100% 4.050 2.835 N RNF213 n/a
12 TRCN0000153316 GCAAGTTGAATACAGCTCCAT pLKO.1 13813 CDS 100% 2.640 1.848 N RNF213 n/a
13 TRCN0000150582 GCTGAAATGGAATCGAGAAAT pLKO.1 15004 CDS 100% 13.200 7.920 N RNF213 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024905.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08756 pDONR223 100% 14.5% 13.8% None (many diffs) n/a
2 ccsbBroad304_08756 pLX_304 0% 14.5% 13.8% V5 (many diffs) n/a
3 TRCN0000478695 GAGCTGGGGACCGAGGGTTTTGCA pLX_317 11.1% 14.5% 13.8% V5 (many diffs) n/a
4 ccsbBroadEn_14234 pDONR223 100% 10.3% 10.3% None 1_13236del;14759T>C n/a
5 ccsbBroad304_14234 pLX_304 0% 10.3% 10.3% V5 1_13236del;14759T>C n/a
6 TRCN0000467930 TTTCGTATACAAAATACCATCATC pLX_317 28.1% 10.3% 10.3% V5 1_13236del;14759T>C n/a
Download CSV