Transcript: Human XM_017025616.2

PREDICTED: Homo sapiens trafficking protein particle complex 8 (TRAPPC8), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAPPC8 (22878)
Length:
5397
CDS:
365..4582

Additional Resources:

NCBI RefSeq record:
XM_017025616.2
NBCI Gene record:
TRAPPC8 (22878)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330715 GTCAATGGTATACGAATATTA pLKO_005 4890 3UTR 100% 15.000 21.000 N TRAPPC8 n/a
2 TRCN0000330712 TCGACGTTTAGATCCCATAAT pLKO_005 3064 CDS 100% 13.200 18.480 N TRAPPC8 n/a
3 TRCN0000059944 CCTGAAATGATTGGAGCTGAA pLKO.1 2765 CDS 100% 4.050 5.670 N TRAPPC8 n/a
4 TRCN0000059947 CCTAATAATCAACTTCACGTA pLKO.1 536 CDS 100% 2.640 3.696 N TRAPPC8 n/a
5 TRCN0000330713 CAGCTTCCTTTACCGTATATT pLKO_005 2354 CDS 100% 15.000 10.500 N TRAPPC8 n/a
6 TRCN0000059943 CCCTTGTACTATAACTTCAAA pLKO.1 1153 CDS 100% 5.625 3.938 N TRAPPC8 n/a
7 TRCN0000059945 CCAGAACTTCAAATCAGGAAA pLKO.1 1619 CDS 100% 4.950 3.465 N TRAPPC8 n/a
8 TRCN0000330714 TATTGGCAGGCCATCGATTTA pLKO_005 2058 CDS 100% 13.200 7.920 N TRAPPC8 n/a
9 TRCN0000100912 CGACAGTTTATACAAGAGTTT pLKO.1 1409 CDS 100% 4.950 3.960 N Trappc8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025616.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11640 pDONR223 100% 94.1% 94% None 1_162del;410T>C;3980_3981ins90 n/a
2 ccsbBroad304_11640 pLX_304 0% 94.1% 94% V5 1_162del;410T>C;3980_3981ins90 n/a
3 TRCN0000469077 TTGCTATCCGGCCTCTAAAATGGG pLX_317 4.8% 94.1% 94% V5 1_162del;410T>C;3980_3981ins90 n/a
4 ccsbBroadEn_11639 pDONR223 100% 46.8% 46.4% None (many diffs) n/a
5 ccsbBroad304_11639 pLX_304 0% 46.8% 46.4% V5 (many diffs) n/a
Download CSV